Description :
From Genome Similarity Track
Location :
Scaffold_162:65424- 66477
Sequence
1053 bases(100 bases per row)
CGTAGACCGCAAAGTCTTAAATGAAGCTGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAAACGAAAGCTCGGTGAT
GGCCGCAAGCTTCTTAAGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGCTA
ATGCTGATCTGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAACG
ATCGTCGACCAAACACAGGTACCAGCGATGATTCGTCTGGCCCCCCGTTCGTAAACATGTCAGCGATGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGC
CTCCACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCGCGGTGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTGAACGCATC
CTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCTCAGAGTGCGTTGTCAATCATACGCTGGTAGACCATCGGCGCGTTCTTTAATCCAA
AGGGCATGCGCAACCACTCGAAGTGTCCGAGTGCGCAGACGAACGCCGATACTTTACGTGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGC
ATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCGGCTAACAGGTCGTCGACTAGCGGCATTGCATATTCCATGATCGCGGTGATAGCATTCACCATC
TTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCAC
GCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGTCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATC
GCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGA