Description :
From Genome Similarity Track
Location :
scaffold_145:6542- 11844
Transcript NameFunction/comments
g4556.t1 ABC transporter lipid exporter ABCA1 family

Sequence
5302 bases(100 bases per row)
GCTTACCACGTGCCTCTCCACCATCGTCACGTACGACTACAACTACGCGCTGTGCGTCATGAACTCGGGCTTCTTCGAGCTGGACTCGTCATCTTTCCGG
GGCGCCACGTCCACCGCCATCACGTCGCTGCTCTCTGGCTCGAGCGCGAGTGGATCGACAACTGTAGACGCCTCTGGCTCATGTACGCTGATGTGTACTA
AACCGACCGTGTCAGCGTCCAGCTCGTGCTGCTCGGCAGCCAGCACAGTCATGAGCTGCAAGCAATCGTCGTCCAGTATCGACTACTGCAAGTCTGTTAT
TGAAGACACAGTGGCCGAGAGCCAGCAGTGCGGCCTCTCGTCCGAGAACACCGCTCTTATCGTGTGCACAGCCATCATTGTAGCCTTTTTCACTGCCGTG
ATGGTCGCAGCCAGGATATACGCCAAGAAGCGCGGGGCTGCTGCGTTCGAAGGCGGTGCTGTCGAATCCAGACTGGCTCTGGCAAGTAGAGCTACGTGGG
AAGCAGTCTTGGCTGCTTGGAGACAGGTTACCAACCTCATCTGGAAGAACCTGATCATCCGAAGACGCAAACCCGTGTCATTCGTTTTTGAACTGTTTCT
TCCGGTTATATTGACACTTGCACTGGTGTTTATTGCCAACCTGGACTCGATCTTCGGCACAGGAGACAATTACACAAGCTCGTCGGAGGCTGCAACCACA
TCAGACACGATCCTGTGCACTGGCTTGGACTCTTTGGCGTATACGGACTACGGCGCGTTGAGTACCAACATGTCAACGTTCTACAGCAGTGGGCAGAGCG
TCATTGGCCTCTTTCTGCTGATTAGTTACATCAAGTTTGTGTCCACGACAACAACCACTATGGTCATCGAGAAGGAGACGAGGATCCGAGAGGTCATGAA
GATCATGGGGCTGTCCAACTTCACGTTGCTCAGTTCCTGGAGTCTCACAACGGCAATTTTGGCGACTCCGCTTGCGTTTATCATTGCTGCGGAGCTGAAG
TATGGCCAGGTGTTCCCGATGACTGAGTACGCGACGCTGGTGTTCCTGTTCTGGGCACTGAGCTTGTCCATTGTGAGCTTCAGCTACTTCATCACGCCAT
TTTTTAGTAAGTCCAGAGCTGCCTCTATCGCATCGGTGCTGCTGTGGCTGGTGCTTTTCTTCCCGTTTTTCTCTGTCATGTCGAAGCCCAATTCGTCCAA
GTATTTGGGTGCCCTTGCACCGCCCACTGCGTTTGCATTAGGGGTTGACGACTTGGTGCGTCGCGCACAGCTTGGCAGAGGGATGGCGTATGCAATGGGA
TTGGTGGAGTCTCCTATCACGGTTCCCTCTGCCTTTTCGATGAGTTGGTTTTTGATTTTGGACTCGTTCATTCTGGTTGCTCTAGGCTGGTATTTCGACA
ACGTGATCCCGCAAGAGTTTGGCGTTCGTAAACCGTGGAACTTCCTCTTCGTGAAGGATTATTGGCTTCCTTCCAAGGGGGATAGCAGCGATAAGGAAGT
TCTGGTGCTGGAATCCCCCAGCACAGCCTCATCACCTCAGACGGATTACGCTTTCGCATCACCACGTGGAAGGCGACTGTTGCATCAAACTTCGTCGGAC
GGATCTATCGTTATGATGAAGGACCGACCTGGGCTTGTAGCTTCTGTAGAGCCGGTCAACGCCGTGCTTTCAGAACAAGAACGTAAGGGAACCTGCCTTC
AGATTCAAGGTCTTCGCAAGGAATTTCCGTCAGACGATGGAGAGATGAAGGTAGCTGTACAAGGACTGAACCTTACGTTGTACGCCGGTCAGATCTCCGC
TTTGCTTGGCCACAACGGTGCAGGAAAGACAACAACGATTTCGATGTTGACGGGGCTCATCCCGCCTACGTCAGGAGATGCAACTCTTTACGGTCGCTCC
GTTAACACAGACTTCAACGAGCTTCGCCAGATCATGGGAATTTGTCCGCAGCATGACGTGCTTTTCAACGAGTTGACTGTGGAGGAGCATTTGTTGCTCT
TCGGGACGATGAAGCACGTTCCATACGGTAGTCTGAAGGAGGAGGTGGAGCGTATGATTCGAGAAGTTGGGCTGGTGGAGAAGAGAAAAGTCGCTGCTAG
GAATCTCTCTGGAGGACAGAAGCGCAAGCTGAGCGTAGCTTTGGCGTTCATGGGAGACAGCAAGCTGGTTTTCCTGGATGAGCCCACCTCTGGAATGGAT
CCGTACTCTCGTCGTTTTACGTGGAACTTGCTGCAGCGGAACCGCGACGACCGCGTTATTGTACTCACGACTCACTTCATGGACGAAGCCGACATTCTTG
GCGACAGGATTGCCATCATGGCTGATGGACAGCTTTGCTGTGCTGGGAGTTCGCTTTTCCTGAAGAATCGGTATGGCGCTGGGTACAATTTGACCATGAT
CAAGGCCCCTGGGTGCAATGTGGAGGCGGTTGGTACGTTTCTACGCAATTTTGTGCCCGAGGCTAAATGCTTGAGCAACTTCGGCTCTGAGGTTGTGTTC
CAGCTTCCGTCCAAGTCTTCCGGTGTGTTTTCGACGATGTTGCAAGTCCTTGACGACGAGAAACATGGATTGCGCATAGTTCAGTATGGAGTTAGCGTTA
CCACATTGGAAGAAGTGTTCTTACGCATCTCGCAGGACCGCGAAGAAGAAGCCGCCATGGGCATCGCTGTTTGCGGCGTTGAGGCTGTGGATCAAATCCG
TAAAACGTCAGCGACTTCAGCGAATTCCCGGGGTACTCTGACGGGTCCAATTTCGTCTGAAATGACCAACCGTGCAACATTGTGGAGCCAATACACCGCA
CTTCTAACGAAGCGTGTGCGTATTGCGAAGAGGGACAAGAAGAACCTTCTGAATGCTGTTTGCATTCCACTACTTTTCCTGATCATTCTGGTCTCGCTTC
CGGAAATCGACGTGGCCAGTTTTATGACTACAAGTGACTACGCTACGGAGCTCGCATCGTCGTCGCGCCAAGGCAGGTGCTCCAGTGCGAACTTCTCGTT
GGTCTCAGTCCCGAGTTCTTGCGATAGCTACACTTTCAACTACTGCGATCTTGGCGTGATTGATTGCAATCCCTCAACATGTTGTGATAAGACAAACGTC
GAATCTCCCTACTATGCATGCAATATGTGCGATGGAACCTCGTCATCCAATCCAGTTACGCCGTGCTACAACAAATACTGCCTGGACCAGGATGGTGCGA
AACTTCAGGCCACTTTGAACGCCTTCTTGACTTCCGTCGTGGTGATGCTGGCTTTCGCTTTTGTTCCAGCTGCGATTGTGGCTTTCGTTGTCCGTGAAAA
GAACCCCATCCAGAATGCGAAGAGTTTACAGCTCATTTGTGGCGCCAACGTGTCGGCTTACTGGCTATCAACGTGGACACACGACATTGTGATCATGATG
GTGACTGTCATTGCTGCCATGATCATGGTTCCGTTATCTGATCGGACGCTGACTAGTTCGATGGAGGTGTGGGGAGTTGTGTGTCTGGTTGGCTCGCATG
CTTTAGCTGTGATCCCAATGGCATATTTATTCTCCTTCAAGTTTAAGAAGCATGCTGTGGCCCAGACGTCGCTGCTCGTGTTTGCTCTCTGCACGGGTGG
TTTACTGAGTATCTTCTCGTTCTTGTGCCGGCTCATCGACTTCGACTTGACCCCAGGCAATTCGTCCGACAACTTGACTCTGTCATCACTTGACAGAAAC
TACCTCCGATGGATTTTCCTGTTTTTCCCAGGCTACAGTCTCAACAATGGTATTTACGAGATTGCCACACGAAAGCTGAGTCGTAGCGCATTGTACGGGA
GCAGCAGTGACACGATTGCCCCTCCATCGTTTTTCGGACTCTGGGAAGGCCTGGGCACGGACTACACGTGCACTTCATGCTGGGATGCGATCAGCGGCGA
GACTTGTTGTGTCCGCAACGTCTTCGATCTTGATGTGGCTGGAGCACCAGTCGCCTACGCTGTGGTTGAGATTGTGATATTTATGTTGCTGGTGTTTATC
GTTGAGACCCGCAGTTTGTCGTGGCGTCCGGAAAAACGACCGGAGTGGGCTCCCAATGAGGACGACGATGTGGCTAGGGAACGCCAAAAAGTGGAGCGTT
CGTACCCGACGCAGAACGACAGTGTGTTTATTCGCAATTTGCGTCAGCAGTACGGCGATGGTGGGAAAGTTGCGCTGGATAATTTGTGCCTCTCAATCTC
CAAGGGAGAATGCTTCGGGTACCTCGGCATTAACGGCGCGGGGAAGTCGACAACTATGAAAGTTCTGACGGGCGAGATCGCTCCAACGAACGGATTTGTG
ACTCTGGGTGGCTACGATTTGTCTCGTGATCGTGATAAAGCCCGCCGTGTTGTTGGCTACTGCCCCCAGTTTGATTCTCTGCACGACTTGCTAACGGTCG
AAGAACAGCTGGAGCTTTACGCTCGATTGAAGGGAATTCCTAGCGACCGTGTCCAAAAGGCTGTTGACCAGAAGATTGAAGAGGTGGGGCTGACTGAGTA
TCGCACAAAGTTAACTCGAGGCCTCAGTGGAGGAAACAAGCGGAAACTGTCTACAGCCATTGCCTTGATTGGTTCTCCGAACATCATCTTCCTGGATGAA
CCTTCAACGGGAGTGGACCCGAGTTCACGAAGGAAAATGTGGGACGTCATTGCCAACGTCTGCGCAGCGAAGGAATCGTGCGTGGTCCTCACGACCCATA
GCATGGAGGAGTGTGAAGCGCTCTGCACGAGAGTGGGGATTTTGGTGAGCGGAAAGCTAAAATGTCTTGGAAGTGTGGAGCACCTGAAGCAGAAATTCGG
TCGGGGTTACATTGTGGAAGTGAAACTTCGGGAGCCAAGCACGTCGTCAGTGGGAAGGTTGCAGCTGGAAGTGTATCGCATCCTCGGAGGCAACTGTGCT
GGCATTTCACAGGACCAAGTCGTCAGCTTGTGTACGTCTCTTGGAGTTCCGAATCGCGCACACGAGATTACGAACGGCGAAGGCAACGGCAGTGCGCTTA
ACAGCTATCTGGACACATCTGGTATCATTCCCATTGACGTTTTCTGTGCTTGGTGGCATACGGAGAACATGGGCTCTGCATTACAAGAGTTTTTCCAGTC
CAAATTCCAAGGCAGCCAGTTGATTGAACATCAAGGCGACCACTTCCGGTTCCAGGTTCCGAAGCAGTCGTTGCGACCGTATGCGATCTTTGGTCTGTTA
GAAGAGAACAAGGAGCAGCTGCATGTGAGTGAGTATGGCGTGAGCGAGACGTCACTGGAGCACATTTTCAACACGATGGCCGCCCAGCAAGGAGAAGAGC
AG