Description :
From Genome Similarity Track
Location :
scaffold_21:65410- 121433
Transcript NameFunction/comments
g1148.t1hypothetical protein
g1149.t1 conserved hypothetical protein
g1150.t1 hypothetical protein PHYSODRAFT_533148
g1151.t1 conserved hypothetical protein
g1152.t1hypothetical protein
g1153.t1hypothetical protein
g1154.t1 cytosol aminopeptidase, putative
g1155.t1hypothetical protein
g1156.t1hypothetical protein
g1157.t1 hypothetical protein PHYSODRAFT_356191
g1158.t1 folate-Biopterin Transporter (FBT) family
g1159.t1 conserved hypothetical protein
g1160.t1 hypothetical protein PHYSODRAFT_362528
g1161.t1 conserved hypothetical protein
g1162.t1 TBP-associated factor
g1163.t1 conserved hypothetical protein

Sequence
56023 bases(100 bases per row)
TTTTGAAGAATCTTAGTCCAATCGTGCCCAGAAAAAAAAGAGAGGCGTCCCGAAAACGGGTGACATGTGTGGAAATTCGACAACTTGAGTTCCGCTATCC
TGAGGGAGTGGGGGTGCACGGTGAAAGACTTGCGTCAATTGTCGACAGAGCAAGAAAATATCACGAAGAAGTATTTTGGATCCAAGCGTTGGCCGTGAAA
AAGGCAGTAGACGATTTTCGTCGAGAAAGTCAGCAAAACACCAAAACTCAGTGCTCGACACAAGTTTCGAAATTTGATGGGGCCTGTTCTCAGAGGTTTC
GAGGTTCTAGTGGGTTCTTCTTGTCCACTAACTAAATTCAAGTAGTTGATCATCATCATCTTCTTCTAACGGTGTCTTTCTTCTTCTTAAAGGGTTAAAG
TGGGTGGTGTTATGTTCTCGAATACCGCATGTACACCGTAGATTTATTTTTTTCGTGACCACAACAACGCAGATGTTGTCATAAACGTGTGCGATACAAA
CCTTATAAGACAATGTAGCTGATGTTTGCTTAAACCTATGGGACTTTATATCGCTAAATATTTCTATGACGCTGACTGTATTATACTTTTACTTCTTTTT
ACAACAAACAAACTCAACTAACATTCAGCTTTGCAGCAAGCTCTAGATTCCCACCTTGACTTGATTGGGGGACCCACAAAAGCAATGATCCACCTCCAGT
ACCTGGGAGACCAAGAAATCCGGGCCGCCACCGATCCAGATACAGCGTTTTTCCTCCCAACGCCGTCACATTTGATCTCCACGTTGCTGTTTTCCCCGCA
GGAACGTCCACTTCGTCGATCTTGTGTCCACCAGACTTAATATTCACAGTCACGTCCTTGGTATCGACACTTTCAAACGTGATTTTAACGATCCCATCGC
CTCTCTTCTTCCAAAATCCCTCACTATTGTTGAAAGCTCGTTGAACAATGGACATCCCCAGCGCCTTCTTCACATCTCCGTCGTCGATTTCACCAATGTA
CTCCGTTGGTCCGCATATTGGCTGAAAGTACTCGGAAATTGCTCCGGTAGCAGACCACGGATCCCAAATCGCCCAGAAGCTGAAGGCCTTGTCCGCAATG
GTAAAGGCGTACTCTTCAGCCTTGAGATACGAGCCGTTACTGCTTGTTCCCGACTTGATCAGGTCGTCTACGATGCCTCCAAAAGTCTTTCGAAGCGTGT
CACGCGTAGCAAAAGCCTTCGTCTCGTCAGTTTGTTCCAGTAGCTCGCTCATGCAGTTGTTCGTTGCGATAGGGATGTCGTTTAGCACGAGATTCGACTT
GCTCACTGCTACTCGAATGTCGTCCTCGGACATCTGAGGGTTCTGCTTTCTGAATTCCGCCACAGTCATCCACGTTCGGTCCAAAATCCGCTTCATATCG
TATCCGCAGGTGGAGTTGGATTTTAGAGCGGATTTCAGAGAAGAAATATCCGTCGAGCTCAGCGAGCCCAGTGAATCCCCCAGCGTGATGTTCTTCATAA
ATCCTGTGAATTTCTCCCAACTCGAAAGGATGGCCGCTCCATTGGCCACCACTTCCTTAAGAACGTACTCGGAAGTCATAATAACACTGTCGACGAACTT
GATCTCGTCCGACGCTGATCTCCCGATACAATACGACACGGCAATGGGGATATCGACCACGACGTTGTCTGTCTGGTAGAGCATCGCCAGTATTTTATCT
TGCGCAGTCTGCGGATCTGTAACTTTAATATTTCTGACATATTTCGCCAGCGCCTTGATCAATCCCATTGTGTATTTAGCACACTTGATAGCCACTTGGA
CAGCTCGCGCCAGCTTCGACAGCTTCCCGAAGACGTCGTACGTTATGAAAGAGAGCGTCGTCTGCGCCAGGGCGGTGACTTTGGTCACAATTTCCAGCGC
ACAGTCATCATTCTGCCGAATACACTCCATTCCACACTGAACAGGGAAGGCGTAGGGACATTGCGCCCAGCACGTCCCGAGCTTGCGGTTGTAGCCTACC
GGACACGTCTTGGCGATGTGAGTTTCGCGGTAGCACGCAGTGACTTTCGAGGTATCCAGCGCCGTACCAACCCAGTTCACGTAGGAGGATTCAATCGTGC
TGGTGGCATTGAGCACGCCACCGAACTTTAAAGCGGCCACCATAGCGTTTGAGAGTGCGCTCGAAGCTGCCGATCCGCTGGTGGTCTCGTCTCTTTTGGA
GGCATCTTCTGCGCTGGCTGAACGGTCAAAGGAATGAATTTTATCGACGCTGTCGGTGGAATCACTGCTATCTGCTAAGTCGCTGTCATCACTGTCCAAA
GAGTCGAGAGAGTCATCGCTGCCGCTTGATACTGTCACTGTTGGCGTGTTATTCGTTCTCCAATTGATTGAGGGCGGATCAGTTAATCCGGACGCGGGGG
GTCTGTTTAACGCGTAAATACTCGACGCTGTTTGTCCACGAGATACCGTGGAGACCAACAGCACGGCTAATAACCTGAGTATCATCGCGAGGTTGTTCTG
AACACGGCAAAACGAAAAGTGCTCTACAAGTCGAACCCCAGTCAAGGCAAATCTTCATTCTAGTCGCAGACAGATCATCGGAATGGGGCTAGACGGGCCT
TTTCTCCGTTCAGTGTTGAACACGGCTCAAGTCTTTCCCGTGTTTTAGCCATCTGGTCGCCTCCAAATATCATTTGCCGTGGCGTGGACGACGTCCCCGC
CATTCAATTCGCTGTTAGGGGGAATCTACTGCCTGCCAGAGACACCACACTCTGTTGCGTTGTATCGGTCGAGATGCGAGCGAGGATAAGCAGCAGCCTT
TGAGAAACAACAGTCACAATTTATTGATTTCACTCAAATATCTTGGCGTTCATCCTTTTGCGGAGATTCCTATTTTAGCTTGAGAAAACTGAATCTTGTT
TGAGGTTTGTGAGTCAGAACTGCCGAGATTAATTGCTGTGAATCGCAAATTACGATCGTTCGTCTAATGATTTGAGGAACTCGAGATTCGTAATGATCGT
AGTCTTGATTCGAGTGACGCTGTAGTTTGAATCTAGTCTACGCTCGCTCTATCTTCTACTGTACAAGTACATGTATCCCAGCGCCATAGTGTTTGCTTTC
CGGATGTACGCATTATATTTTCTTCTACTTAGCTCGTACGTCCAAAACTTTATGCAGTTAATTTCAGCTCACATTGAGCACGGCAGTAAGGTCGAGGCTT
CCTTTTGTAGACTGAGGAACCCACAGCAACAACGAGCCGCCTCCAGTTCCAGGGAGGCCCAGAAAACCTGGTCGCCACCGATCCAGATACAACGTCTTCC
CCGCTAGATCCGTCACATTTGCCTTCCAAGTTCTGGTTTTGCCCGCTCGAACTAGCACCTCGGCGATTTTATCCCCACCGGACTTGATATTGACGCTCAC
ATCCTTCGTATCGGCGCTCTTGAAGTTGATAGTGACAATACCATCGCCATTTTTGGTCCACAAGCCGTCGCTGTTGTTGAAAGCTCTCTGAACAGTCTTC
ATCCCCAACGCTTTCCTAACATTCCCGTCGTCAATTTCTCCGATGAGCTGGGTGGGTCCACAAATGGTCTGCACAAACTCGGAAATGACCGACGAGACGT
AAAAAGGGTCCCAAATGGACCAGAAGCCGATCGCTCTATCTGCGATCTTGAAAGCGTACTCCCCAAAACGCAGCAACGTGCCATTGTTGCTCGTCCCAGC
GCTGACTAAGTCGTCCACAATGGCTGCAAAAGTCTTGCGAAGTGTATCCCGCGTGGCATACGCAGTCAATTCATCCGATTCCGCCAATAATTCGTTCATA
CAGTTGTTTGTCGCGATCGGGATGTCGTTCAGCACGAGATTCGAGTGGCTCATGACCACTCGAATGTCATCTTCGGAGATTTCAGGGTTGAGTCGACGCA
GTTCTGCCACTGTCATCCACGTACGATCCAGCAGGCGCTTCATGTCATAGCCACAAGTTGTGTTGGACTTGAGTGCCGACTTCAAGGAAGTGATATCCCC
ACCACTTAACGAAGAAACGGAGTCTCCTAGCGTGATATTCTTCATGAAATTCGTGAACGCACTCCAGCTGGAAACAATGGCAGCTCCGTTGCTTATGATC
TCTCTTAACGCGTACTCCGCAGTCGTGAGGACGCTGTCAGTGAATTTCACGTTGTCAGAAGCTTTTTTCCCGATGCAGTACGAGATCGTGACTGGAATAT
CGATGATAACGTTGTCAATCTGGTACAAAATGGCGAGAAGCTTGTCTTGCGTCGTTTCTGGGTCGTGAACTTTGATATAACGAATGTATCGGACCAGAGA
CTTGGTGAGGCTGATCATGTACTTGGTGCATTTGATCGCCACTTGAACACTTCGTGCCCACTTAGTCATATCTCCATACACACTCCAAGCAGAGAGCGAG
AGCGCTGTCTGCACTACGACTGCGACTTTATAGAAGACTTCCGCCCCACAGTCGTCATTCTGTCGGATACACTCGAGTCCACAGGCAACCGGATACGAAT
ACGGACACTGCGTCCAGCACATTCCCAGTTTGTCTTCATACCCCAGAGGACACGTCTTGGCGATGTGAGCTTTGCGCCAACACGCGCGGGAGTACGAGTC
GTCGAGAGCTGTTCCAACCCAATTAACGTACGTCTGCTCGATCGTACTGGTCGCGTTGAGCACACTGCCGAGCTTAAACGCTGCGTTTAACACTTCCACT
GCGGATACCGAGCCGTACGCGTCCTCACTGTCAGTCGAAACATCGTCGCTGCTGTCGTCGGAGTCGTCTTCGTCTGCATCTCGCTCGGAGGTGTCGTCGC
TATAGTTGAAAGGCACCGAGTTTCGTTCACTTCCAGTTAAGTTTCCTCCATTGCTGTCGTCATTTGGAGTCAACAGACCAGCAGGAACCACTGTAGAGAG
AGGCATTGATGCTGATTCTGCACCGAACGTGGAAACCTTCGCCAGTGATGTTCCTTTAACCAGAGCTGCATACACAGCTAGCAGTATTATAGTCTTGATC
GTATTGACGGAAAACATGGAGCACGCAGTCGGTAGAATGGAAAATGACGATACTCACAAGCTTTTTGTTTTCTCCAGTACCGCCGGCACAGAATCATCAC
GCATTTAGCGAGCGACGTCTTCTTCAAAGCCGCGGCGAATGGACCAACGGCCCGTTGGCAACGGGGCTATTTAATACTGAGAAGGCACTGCTTCCAATCA
CTTGTATGATTTTTTTACTGTCTCTCGTTGAGCACCCCACAAACGTCATGACGTGGTGGCAATCAAGATCTTAGGATTCAAAGAGGATTGGACAACTGGC
CAACCTCCACCACCGGTTGCTAGAGTACGTAGTCAACTGCGGCACGCTCGGAGCTTGCATCAAGAAAAGCGTGATTCTGATTAGCAAAACGTTATCCATA
AAGTATAAAAAAAGACTTCATTCGTTAAAAAGTGTTTTGTTTTGGATAAAACTATGGTGTGACGCACATAATCCGTCAAAGCATTATCGGCGCCACACAT
ATTCGCTGCATAGATAGAGGAGCATTATGGTGCAGGTCTTGCTCGGGGCTCTCCGTGCTGCAGGCCGTCGCGCCGCCGTCTCCAGGTTCCTGACCAGCCA
CAGTATGCTCCGAACTGCCTCCTTCGCTACTCAGTCCAGTGGTACGTGGACGTAAACCTGTATTTTTAAAGTTATATTTGTTTGGTCTCCCCTAATTCTA
TTGTATTTTTATTGTTTTTACTGCGTAGTATACACGTGGGGCAACGGCACATTGGGCCAATTGGGCCACGGACCGGTAGTCAAATCCGGTATCCGTAATG
CGTACGAAGAGCTGACGCCTAAGCTGGTGGAGGCCTTCGAGGGCAAAGCCATCACCCACGTCGAGTTCGGAGCCAGTCATAGTGCTGCCAGTACGTCAAT
TGTCAATTATTTTATGAATTTAAAACCAATAGTAGACTGACATGGTGCTTTATGTATTTATTTTAGTTGACGAGGAAGGCAGATTGTACGTGTGGGGCAG
CAATGAGTACAGCAAGTTGGGCCTCGGAGAGACCAGCGAGATGGAGGAGCTCCCGCGTGAAGTGGAAGCGCTCAAAGGCATTAAATTTGTGGATGTTTCC
TGCGGTGATTACTTCACTGCGGCTGTGGATGAGGACGGCAAAATGTACTCGTGGGGCTGGGGAGGTTCCACTATGAAAGGTGCTGGAGGCCTTGGCCATG
CCGGTGGAAAAGACGAGCCCACGCCTCGACTGCTGACCACTTTGGTGGACCAGGGAGTGCCTATTGCCACGGTTGAGTGTGGCGAGTTCCACACGGTGGC
GCTTACCAAGGACGGCGAGATCTGGGCCTGGGGTAATGGCGAGTACGGACGACTGGGCAATGGGGAGTCCGACACGTGCGAGGTGCCTGAGCCCATCGAG
TTTTTCTCCAAGGACAACGTCGTGTCGATCGCTGCTGGACGCGACTTCTCCTTTGCTTTGACGGACAATGGAGAGCTCTACAGTTGGGGAGGCAACAGCC
GTACGTTGATTTCAGCTTTCTTGACGAAATTTTGGGCATTATTGACAGTTTTTGGTGGATACAGAGAATCAATTGGGTATTGGAGGTGGTCTGGCCATGG
ACGTGTATAACATCGAGTCCATTCCTGTACTAGTGGAGGCCTTCAGTGGTCTGTCTGTGAAGCAAATTGCTGCCGGATACGACCACGCCGCTGCTGTGAC
GGAGGACGGACGTCTGTACATGTGGGGCGCCAAGATCTGGATCGAACCGCGTGAGATGACGGCTGTGAACGAGCACAACGTGGTGCAGGTGGCTTGCGGA
CGGCAGTATACAGTGGCGTTGACGGATGACGGCAAGGTCTTTACGTTTGGCAAGGGTAGTTCCAACTGTCTGGGCCATGGCGACCGCAAGAACCAGTTGC
AGCCTGTTCAGATCCAAGCTCTGGCCGATGTGAACATCACCTCGTACGTAAATTGGCACTTTGGAACGGCGGGCTGATAGAATGGAAAATGCTCACTTAT
CTATTGTTTACTGTGACGCAGAGTTTCGTGCGGCGACTACCACATGGGCGCCATCGCGACACCCCACGCCGAGGCCGCAGACAAAGATTTTTCCTTCCGG
GAGTAGGAGGCGAGATCCAGTAGCTCCAATGTAAGCCGTACCGGATAATGGCCAAAGCTGATGTTGTCGCTTCAACCTGTTTACGCAGCTCCGGTCTCCT
GTCGTGTAATCCGTCGCTTCCGATCTTTTTGCGTCCCATTTAACCTTCCGATCTTTCGATGATTCGCTTCGTGCTGCTGTTGTTTGTGGCAGTTCTGCCG
TGGTTGCTGCTGTGTGAGACTCCGTCCGAGTGGAGATCGCTGAGTTGGTGGAAAGGAAGACAAGAACTCACCTTTAGCCTGGATACGTGGCCGGAGCCGG
TCATCAACGTGGATGAGTGTCTGACACTTTACCGAGACGCCAAACACAACGAGATCTGCGTCATCAGCCGCTAGAACGAGAACCCGTAGCTGTCATCGAT
TGAACAGTAAGAAATTATCGCTTTTACTTGCCGTCGCGCTTGCGTTTGAGGTTGTTGCGGCTCTGCATGACAGCGGAACCCGTGCCGTCCGATGCGACGA
CGTCTGTGACCACGTACGGAGCTTGAGCAGGCTCCTGCGCAGATAAAAGAATACTATCGAGCGGCATACTACTGCGTACCAGTAAGTTCACTCGTTTCAA
GACTAAGAGGGGCAGCGGACTTAGGAGGAACAACTGACGCCTCTCAGCGTCCACAGCTCGAACGATTCCCACACCGAGACACGGGGCGTGTACAGGCTGC
AGAACGATTCGTGGCGGCCCTTCAGCTTCGTCGTCACTGCTCGGTTTGTACTGGGGATTGATACAGAGACCCACCACGCAGGCGTTGAGAGAGAAGAGGA
GCTGACTGGGAGCCACGGATGCACCGGCGAACGCAACGTCCACGTGGTCGAAAGACACGGTGAATGGAGTGAGTTGGGCGTACGCGCGGTAGATGTCGCC
GTCCAGACGGTTCTTTTCTGACAGGACTTGGAGATTCTGGAGCTGGACCCGCGGGAGAACACAACGAGAGCGAGACAGGAAGTACGAGTGGAAGCGGTAG
GTCCGCAGCTCCTTGGAGCTTCGAGGAGGCTGCGTCACGCCCACGGGATCCCAAGGCGGCACGGCGTGGAGACGCCATTTGCCTCCCGTGGGGACGTCAA
ACTGTTTGTTCTTGGTGGCGGCTACCAGCTGCACGACGTGGTCGGGGTTCGTCTCCTGGATGACGTTGCACAGCAGGTCGTGGCCCATGCTCTTGATCCA
CCCGTCCGTGTTGATCACCAGCGGTACGTTCGAGTCTTGAGCCCCCCACTTGACTTGGTACAGGCGAAGCAGACTTTTGACCGCCTTCATGTAGTACAGC
GGGTCGTTGCCTGGGTTTGCGTTGCCGCAGAAGAACGACCGGATCGGGTTCTTCATGTGTGAGAAGCCCGGACCGAGCAGCGGCGTCGTCAACGCGTGGA
GCGCCACCAATCCGGACGGCGTGAGCTCACTCTGCCCTAAATCTGTGTCCAGGAAAGCCACAGTGCCGAACTTGGCCAGCAACCGGTTCACTAGAAATCT
GCAGAACGTCGACTTGCCCACGCCTTTGCCTCCGCACACGACGATCTTCTGCGGCGTCGCGTTCTCCAACAGACTCGACTGCAGTCTGTTCGCTGTTGCT
TGCCAATGTTCAGTAAAACTCAACGTCTTATAGGAATCCACGACCACCAGCTCAGCGAGAACTCGTTCCGGAGTCTTCCAGTCGTGATGGGATGGATCTG
TATCTAACGGAGCAGCACTTGTGCAGTCGAAAGCAGCTGTAAGCGCACTCAAAACGTTCTGGTTGTGCTTTGCGATGATCATCTTGAAACCTGGAAGTAC
GACCGACAGCTTCTCTGGTCGTGTATTCTCATAGAAACTCGTAATGTTCCCGTACGTCACAGGGATGGCACGTAGCACCAATACAATGGGGAAATCATCC
ACGAGTTGCATGGCCAGTTTGTCCGCAGCGATCTCCTCGTCCTCGTTCACGGCTTCCGCAGGTAAATTCGGCCCCATAGCTTGCAACAGACTGGCGTTCG
TAGGTCCGAAAGGCGACTGGGTATCTTCGTTCCCTGGCCGGCCTTCAATTGCCAGCAAACTGCTCCATTTGGGCGAATGCAAGGAGAAATACACGCCCAG
AGGAGGTCGGAATCCCAATACCTCTACGTTCCCCTGGAAGACTCGGAAGAGCGTCATACCTGCGCAATTGACCGAAGCAGAGCGCTGCATTCCCAGCGCA
ACCACATTGCCCGAACGCACGCTTAATGCGCGGAACAGCGGTGAAGAAGCCGCGTCTCCAGCCGCAGGTCCATAGTGCGAGATGTCCGCCATCCCTGATA
ATGATTGGCCAGTAGGTAATTTGATGGAGTTTTCACACGTCACATGAACTTTTAAGTTTAAAAATGACAAAAAAACTGCTTCAAGAATATGCAAGCTTCC
AGGCGGAGGTGACGAAATATGGGACTCCTATTCTAGGTCATTGTTGGTGTGGTTGCATTGGAGCGAAGCTGCTAAATGCAGCCGGCAGGACGTCGAGTTA
TTTTCGAGGGGGTCGTCTGATGATAACAGCCGACCATCTCCTGTATAGCAGCGCTACAAGCTAAAAGCGCCAAGAGTTGAACGAGTACGCGGTGGTTCGA
GGCATGTTACCGGCGCTCACCACCAAGCCCAAGCAGGCGGTGCGTCAGGTTAAAGGCTTGACGAATGACTCGATCGATTCGTACTCGAACCCGCCACTGG
GCGGCGGTTCTGGCGGGATGGCGGCAACGTACGTGGATAATACCGAGTCGGGCAACGGTACACCACGGTCACCAGCTTCGAGCAGAGCGATAATTAACAC
GGGACGTGTGAAGTCTGCAACTGAGGAAGGAGTGGCAATGGCTCGTGTTGTTAGAGACCGGAAGGCATCGGGTGAAGAGGAATTGACACTACGTACGGGT
GACATCGTGAAAGTTCTGTCCTCTAAGCGTACCGGATACCTGAAATGTGAAGCTGGAGACGAAGTGGGCTACGTACCGTCGTCCTACTTGGAGTTCCTAG
ACAGCAACGTTGAAGAGAATGGCAGTGGTAACGCTGTTGGCGATGAAAGTCAGCGAGCAGGTGAGAAACAGCGCAAGAAGAAAAAGGAGAAGCGGAAGAA
GGAGAAACGAGACGTTAATGACACTAGTGAGACCGAGGAAGCGGCTCCACTGACCGTCCGCTCACCTCGTAAAGAAGTCGCGAACACTGAAGAGGACGGC
ACCGATTCACCTCGCAAGCGGAAGAAGAAAGACCGGAAGCATCGCGACGCAGGTGAAGACACAGCAAGAGGAGCAGTAGTGGAGGAACCACCTATTGCGA
GATCTCGAGAAGATACGGAACGAACTCGTAGTAAAAGCAAACACCCCAAGAAGAAGCGCCACCGTGATGTAGATAGCAGTGCTTCGAGTGAGAGTGATGC
AGGGAAGCGTAGTGCTCGTCATAGCCGTCGTCGCCGTCATCGGCGCGGGTCAAGTGCGAGTGACTCCGATTCAACGTCTTCTGACGATTCAGACGGGAGC
TACAGACGGAGACGACGTCGTCGACGCCACCGACACCGTCGCAGCTCCAGTGAGGGCGAAGACGAGGACGATAGCGACTACAAACGCCGCTCTCGACGTA
GTAGAAAGCGTCGTGATAAAGCAAACGGATATTCGGAACCTGAAGAAAGCTCTCGGAAGGCCGAGAAGAAGATATCGGCAACCGTGCAAGAAGTTGAGAA
AGGAGTGAGCAAGCTCGACGTCAAGGCTGAAGAAAAGGCGTCGGAATCAAAGCCTACCGCTTCGTCAGGTAAGAAGGAGGAGCCGAGTCGAGACAGAGGC
AAGAAGGAAGAGACGGAACGTAGTGAAGGTTCTTCAGAAGGACGCGCAACTAACGTATCATCGAGTCGGAAGGATGACGAAGGACGAACGAGTACCAGCA
CATCGTCCTCCAACAAGCAAAACAGTAGCAAGTCCGGTCTTGGCAGGCAAATCGGTGAAAAAATGCGGTCATTCTTGGGCGGTGGCAGCAAGAAGCAGAG
CAGTAGCAAGGGTTCAAGTGGAATTCTGAATGCGTGTACAGGTACTGTGCAGGGTGAAGAAGGATGGTACGAACATGGCGAGAATGAACGCTACTACTTC
GTGCTTGTGGATGGGAAGTGGAGTCTTCTGTACGGCCCCATGACTGAGGACGACTTCGAAGTATATTCCAACCGGGTACGTGGCCTATTTGGTCTTGATA
AAATCGCTGTGCTAACTTTTGCTTGCAGGTGGTGGAGCAAAATCGCACTATTGAGCTGCCACCGACGTATCTGCACAAGACTGGATACTATCTCAACCGC
GAACTGCGTGTGCAGAAGGAGCAGTAAACAAATGATCTCAAGCAGCGCTACAACTTCTATCAAATTCATCAACACGAAAGTACCAGTGCACAATATGTAT
CATTCATTCATAAAAGTCGTAAAAGTTCTGCAGGTTAGTTCACCACTTACTTAGTCAAAGGTTTTGACTCGCTGGTAGTTTCCAACACCAACTCCTTCGG
GAAATAAACTTCGGGTGCGATAGAGACCTCTTGCACGCCTGATCCGGCCAACCACTGGCTAGGCGATCTCAACAACTCCTTCAGCTCATCACTTAGCGAC
AGCTTTCGACGAGGAGATAAAGGTAGCGCTTTTGGCTCGATTTTCACCGTCTCCGCCTTGGGTTTACTCGGAGAACCAGCTGAAAACGCTGTGTTTGCTG
CGACTGCGTTCTTCACCACGTTCCACTTCGTGTGTTTCTCGTGCGGAGACAGTGGCTGAGCCTCTCGCTTAGAATGCGACAACTCCTTCCACTCTGTGTC
GTCCGCGGTTTGATTCGCGATATCCTCTTCCACGTCCAAGTGCAGCATGGATGGCTCCTTGCGCTGCCCAAGCCGAACTTCATTTAACTTTCGGTCCACA
AAAGTAGCCTGGAGCTCAGGCGCAACTCGCTGGGCAGAAGCTGCGACTTTTTCTTCATTCAACTCCTCGGCGCCTGCCTTGCCTTCCGTGTGATACTGCA
TCATTCCTAGCAGTTCTGGCGTGCGGGTAATGCTGAAAGTTCCCTCGCGGTGCATCTTGACAAGCTCCGTGAGGTGCTGCTGATTCGGCAGCCAGTGCGT
CGCGACCGTGTGATAAGCTTCTCGGTGGCGATCGTTTAGTCCCTTGGGCACCACACAAACCTGCTCAAGCTTGTGCAACAGCACTGGTGTCTCTTCTGAA
TGCAGCTTCCGGTTGTTCATGCATCGTTCGGCATGAGTCACGAGCTTCTCGAGCAACTCGAGGTTCTCTTGGTACCGTCCTTCGAGTTTCGCTTGCGCCT
CTTGCTCACGGGCTCGCAACTTCGAACACTTGTCCCGAACCTCTCTCAATAGCTTCTCTGTCTTCAACATGTCCATCTTGTTAGCAGCTTCGAAAAGGAG
AAGACGATCCAGCAGAATCTTCACTCCCACACCTTCTCCAAACTCGTGGTCACACCATCCAAGTCCCCGCTGCAGCCACCGATTGCGCAGTGTGAAAGCT
GCAGACGCCCACTCTAGTCTTTGACGATGAGCAGCGGTTAGCTTGCGTTTAATGCTCAACTTCGACGCGTCAAATCCCAGCAGCCAGTCTGAAATCGACT
GGCTGAATGTCCGACGTTGTCGCTGCATTGGAATAAACGCACCATCCAGACTACTGCTCTCGTCATACGAAAAAGTATCTTGCAGCTGATTCGTCACCCG
ATCACCTCGTGAGCGGAAGCTCGTGACTTCCTGGAAGACGTTCGCGGCGTAGCTGACGGCCGCGTAATGAGCCATGGCGCTTGCGTTTTTCTCCATCGGA
CATCGTGACAGCATGGCTTCACTTGGCGTACGAATGCGCCCAACCGCGACTGCTTGCCGAAGTTCTTCCCTCGTAAATGCCTCGGGTGGAAGTCGGTAGT
TCGCACCGACAACTCTCTTGTTGACGTTATACAGCTCCGTGGCGATGTCTTCTTTGGTCACAACCTCGTCTCGAGACTTGCCCAGTAGAGCTCTCATGCA
TCGGTCCTGTGCTGCGTACGCTGCTAGCCGTTTCGTGTATGACTCGTGCACTAGGAGCCGCTGGAATCGCTCAACAAGAGTCAGATAGTCGCCATTAAGG
TCAACCTCGGCATTTCCCACTGCAGCAGCGAACATGTCGGCTTCAGACCTCTTGTTCTCCTCATCGAGAACGTGGGATTTAATGGCGAACGTGCGCACCA
GCGAGTTTCGCTTGCGCAGTGCTTCATACAGCAACGTTTCACGGAGAGCCTCAATTTGTGTGTCAATGATGCCTAGTCCCGTGTTTAGAGTCTTGGAATG
AGGTGCTGCATTGGAAGTCTGCGTTATGGGTTGGGTACCAATACGGACCCCACGAAGCATCACAGGCTCGCCCATGGTGTCCATCCCTCGTTCTACAAGT
AGAGTCTGGATACTGTGAATGTCTTGAGGAAGAGCTTCTTTGATCTGGTAACGGGTCATGAGTTGTAGCAATGCCGTAGGGTTAGTCGTGTCGGTAACTG
TGATACCTTTAGCAGCCAATTCGTCATTTTGCAACGCGAATTCGAGAGATTTCACCAGTTCCTCAACTTCCGCCGTTCGGATGTGCCGTATCGTCATCTC
TCGCAGCAGCACCTGGTAGTTCTCCGGGACTACCAGCTCGCGATTCACACTCACAGCATTATTGACAATCCAGAGCAAGTCGGTCTTTCCGAGACTCTCC
ATCGCTTGGTAGAGCTCTGCTACACGTTCTGGGTTCGCTAAAGAGAAGGATTGTTGCTTGTTATCACGATGCGATTCGAGGATTTCCTCGAACTGCTGAA
TTTCTTCGTCGATGTGTTTTGGCAGTACGACAGACTGGGAGCCAGACTTCGAATCCAGTAGTGACGGCTGGACCCAAGCTTCGTCCTTTGCATTTGCGTT
ATACTGCACGTCACCGGTCGGATCAAACAGTGAGGTCTTTGGAATTACGCCACGATCTTCTAGTGCGAGACGAACATTGGCATGTGTGAAGAGCATCTCT
TCCTGGGTAATTGTCAGGCGTGTATCCTGTCCATCACGTGAATACAGCAGCCAATTCTTCTTCTCGACATCTCCCGTGATGCGGTGGTAAGGAATTCGTT
CAAGTTCGTACTTCGCTTCCTCGATGGCATACCATTCTTCCATGCCTTCCAATTGATCGATGTCATCGGCACCATTTTCAGACCTGAAGCTTCCTTCAGA
TGCTACGGAGTACTGTCGGGATATCCCACGCTGTCTACGAGCTGCTGCGTCATCTTTACCTTTTGGAGATAATGGAGCGACCCCACTAAGACTGGACGAC
CTCTCACGCTTAGTCAACTCTTCTTGCCGTCTTAGACGTGAAGGCTTCCACAAGTGCATCTTTTCCAGGATCAAGGGCGTCTGCTCGCAGTCAATAGAGT
ACTTCAACTGCATTTTGACAACCTCATTGAGCCACTCTTGAACTTGTTCCCATCGATTCTGTACAGATTCAAGAGCTGCAGCATCGACAGGTGCAAAGTC
TTCGCACTGTTCATCGAGAAGCAACAACAGTTCATGAGTGCGTCGCCAGTGCAGACCTGTCTTCTCCATCAACCGGAGTTCACTTAGAGGCCCGTTCTCC
TGCGTGATCGCAATCCAACGAGCCTGGGTCTGCGATACTGCTTTAGAATGGCGGGGATTAAGTCCTTTACTACAACGCTGTTCCACGATATCCAGTAACT
GAGGGGCTCGAGTCAGGCTCAGTTTGCGCTCCTGCATTCTCACGAGTTCCTCCAAAATATCCAGTAACTTCAGCCACTTTTGCTTCACCTGTTTCCACGC
TGTACTCAAGCCCACGTCCAAGCCTTCAATTTCTTCCTCAATATCGTCAAGTACTTGGGGTGTGCGCGTTGCGTCAATCTTTGAGGCAGCCTGAATCGTC
AAGATCTCGTCCAGTTCCGGCTGTAGATTAACCCACCGCTTGTGTACTTTCATCACCGCTCCCCGATAATTACTTGCCATTCCGTCGAGTTTCTGAGCAT
ATTCTGCCTCTTCAGCGCTAGTCGACTTCTTGCTGTGGGTGGGGGAGGTTTCATGCAAAGCAAATATATCCCAGACGAGATTAAGCAGCACTGGCGTACG
CTCCCAGTGAAGCTTTCCATCGGCCTGCATCATGAGCTCATCCAAATAGAGCTTGATGGTCATCCAGCGACGTCGTTGCGCTGGCACAACAGTATCGTGG
ATGCGCCTCCGAGCTGCTTCGTGCTGTACAATGTACCGTTCTTTCCAATTCTTGTACACACTGATCGCTTCTTCGAAGAACGAGCTTTCCGACACTTTCA
GATGGAGACGCAAACGTAGTTTTCCTCTACCTTTTTGCCCCTGAACTTGAGCAGTATTCCGAGCGCCGCTCAAGTTCGTAGTGGGTAAGTACAGCAGCTC
GTAGATGTCATCACGAGGTTGTTGGTCAAGAAGATCCATCAACGGGATGCAAGCGGTGCCGAGATAACCATCAACGTTGCTGCGGCCTTCATCCATAACA
TTCACGCGCACCGAGGCTCTCATAATCATGTCAAGGACTTGAATGAGTTTTGTGAGGCGAAGGCGCTGATACAGTCGAAGACGGACCTTCTGGTCCTCTG
GCTCGAGTTCTTCCACTTCAGTATCAAAAAACGACAGCAGCTTTTCGCCTCTAACGATGTCAACGTTGTCACCCTTGGCATCCAAACTATAGAGTTCTTC
CAGCCTTGAAATGAAATGTGTGGCTAGCACTTCATACAGCTTTAACACTGTGCGCTGCATTCGAAGCGTGCAGGTGGTCACATTTGCTTCTACTATCACC
ACATCATCACGGTGTTGGCTCTCATTCTTGTCAGCATGAGGATCGAACGACCACGGAAGCCTCTGGTCTATCACGTACTGGCCAAGACCCAACTCTGCAG
CGGCATCTCTCACAATTAACTTCGTGTTTTCCAGTGTGAGTTGCAACTGATCGAGCGCTCGAGTCTTCAAATCCAAGCCAGACAGTTTGGCATCTTTCAA
GGTGGAAGACACCACGGACACGGAGTGAGACGACTGAGCCTTTGTCGCAGCGTCAAACATCTGGACCTTAGTGATCTTTTGTAGCTGAAGTTCCATGTCA
TCTGGTTCTTTCAGCAACAACTTCCCTTCACCCAGGACTGGAGGACCCATAGCCAGGAAGCTACGCGACAGCTTGTTTTCATGTTGCTCTAGAGTCATTT
TGAGAAGTTCAGTCGGAGAGATAGTCCAGAAGTCCACAGATTTTTCGAGCTGCTTGGCGTATACCTCTGCACCAGCACCGTACTTTTGGATTCGCTCAAT
GCACAACGAAAGCGTTCCAACTACAACACGTTTCGAATCAGATCCGTCTAGCTGCAGGTGGTAGATGGGCTCATCTTTCCGCTTGTCGGTACTATTGACT
GACTGGGCAACAGCAATTTCCTCCATTGGGACCGTGACAGTTCCGATCTTGGTCTTCTTGTCTCGAACAGTTAAAATCACTTCGGAGACGCGATCAAAAT
CAACCTCTGAGTACTTAAACTCAACGTGAGAGAGCCCTTTCTTACTAGCCTTCCACGTCACTGATGGAAGTTTCGTCTCCTGTACGATTGCACTGTCGTA
CGCCAGCAAAAATGTCGAAGTTTTGGGGTACATATTCGGTAAGATTTCGCCTACCGAAGAAACCTCCAAGCCGAAAGGAGTGGTGATCTTCTTGCCTTTG
CTGGTAGTCATGTGCTTCTTGAAATCACTGGAGATTAGCACGACTTCCACCTGAAGATCCTCACCTAGCGTCTTGTCTTTGAACGACATATTACTCGCTT
CGAACACTTTCACGTACAGCTTGTCGAATTTAATGTTTCCAGTCGGTACCTCCACGCTGGCGTTCGAGTTTGACTTCGGTTGCGCAGAAGTTGTCTTGTC
CACCGGCACCTCATCGGCATTTCTCGTCCCTGATGCAAATTGCACGCTACATCTCCTCGATGAGGGCTCATTTGAGTCCGACGGTGGGGAAACGACTACG
GCTTTGTGGAATGGAACAAGTTTGCTTCGAACTTTAGCTTCCGCCAAAATGTCATCAATCCGGAAGTGGAGATCGTGACTATTGTTGTCGGAATCACAAA
CTCTCACACGAATATCTTCCAGCGGCGCAAGCGAAACTTCCGGTTTCAGGTCGAGTCTGCCCGATTGGCTACTAAAACCAATCGATAACGTCCTTCTAGG
ATTGAGTGTGCTCTTGAAAGGCGCCATAACCCAAGACAGTTTATCCACAGCACGAGGGTCCGATAACTGCACGTCACCTTCTACGGCGAGGGTGTTTATG
GTTTGGAGTCGCTTCGAAATGGTTGCTGCATGTTCGTAGGCCATGGCTGTAGCTTTGATGGTATTACACTGGTCGGTATGAGGAACGGACAGCTCGAACA
TAATATCAATACTTGCATCCATCCACGACACCCCAGCTAGATCTTTCAGGAGGGCACTGGCATCAACTGGGATCATGTCCTTGGAACTTGGTCGTGTCGG
ATTAAATACCACATTGCGAGTGTGTTTCTTAGCAAACTCCACTTTCACACGTTCAATAGCCACCCGGCACGTTTCCGTGCAGGATTCCAGGTTCGTATTG
TTTTCCGCACGCAGCAGTTGTTGAACGAGTGGCACGATTGAGCCCGGAGCCTTCGTTATTGTAGCCAGAACCAACACCTTGAACAGCGCTGCAGATTGAG
ATGACGAACATACACGGAGCCGTCCGCGCACTTGAACAAGCGGAGGCGGGGATAATAGCAAGTAGAAACAGTTCTTCTTACTGAAAGGCGCCATCGCGTG
TGCAGATCCGCTGTGCTTACGACATTTTGACACAGCAGCGTGTATCAGCTTGAGCTGCTTCTCCTCGGTGTCATCCAAAGTTTCCCCCTTAACAAATCCA
TGATATTGACCGAGGAAACGTGATTGATCTTTGTTCTGCTCCAGAAGTGCTGTTTCCATCAGTTTCTTCGTGGTGGGATTGCGGACTGTAACAGATTTCA
CTGCAGCTGGAAGAATCGCATATACCTTTACGATCTTGTCGCTGCCCCACCAAAGCCTGCTCAACGTTGTAGCCATGTTTGAAACCGAGTCCGACGCTCG
CTCCATCGTCTTACCAAATACCGGCAGGCTCGAGCTGAAAATGGCTCCAAGAAATGTCGTGTCAGTCGCTGAGTATCCTTGACGCGCTCGGATCTGATCC
CGTGCCAAATTATCGATCATCTCGCCGTTCTCAAGGCAAACACTGTACTTAATCTCGGGAGGCCCGACCCTCGGATCTGCTGCAGAAGGATACATGGCTG
CTACTTTTCCATCATACATCGCTTCAGAGAACACTGGAACCAAACGAAGTCTGTTCACCGCGCTATCATCAGGAGGTAGTTGTCCATCGGTATATACAAC
GTCATACCGTGCATCACCATAGCATCGTGTGATCTTCCCAGGACGCATTCTCCCACTGCTAATGAAAGAGCTATTCGTCTTGTTATTGTCGGGTTGAGAG
CCATCCAAGATCGAGAGACGCTTTGTCGAGTCTTTTGAAGCCACAAAAGCTTCGCTAATCTGGACGTAGTCTTCCTTTTCCAGCTGAGCCTTCAACATCA
CTCCCTCCGTCTGCAAGAGCATTGTACTTATCGCTCTTTGCGTTTTCCATTCTTGACGCGGCTCTAGGTTGTCTACGTATTCAACCAAATACGGGAATTC
AGGTTGGTTGACGCTATCATATTCTTTCAGTATTGCAAGACGTTCTCCTGGCAATTGGTTTTCTCCACTGGAAGTGCTAGTCTCATCTGCAAATGGGCGG
AGTTTGACGTTGAATCGACCCCCACCGCATTCCTTGACTATTCTTCCGCCAGAAAACCCTCCATCCAGTAACTGAACATCCACAGCTACTCCAACACGCC
TAAAGAAGGGCACTTTGACAGTAACTCGATCGTCCATAAAGAAAGGACTCGAACGTTCTCGGGTACTGGGGGTCATGCTGCTATTATCACTGCTGGACTC
GCCACTGAGAAATGAGAAGTTGAACCCAGTCCACTCACACTCTGTGAACAGGGTTTCAATCAGTCGCGGTGTCTTCTTCCCGTGAAAATGGCCAGTCAAA
TAATCTTTAGCCTCAGCTACTTGCGTTAATATGCGTGACCAGCGATTGAGGATTGCGTCTAGCGCAACCGTATCGGCATACGAAAGCCGGTCGTTTTCTC
CACTTAAAAACACGAGTTCAAACACGTAACCCAGCAGTTTGGGTGTAATTTTCCAGTGAAGCTTAGAAGCTTGGCTCATTGTGCGCATTTGAGTCAGCAG
CTCCTCTGTAACATTACGACTCGAGAAATTCGACTGGCAATTTTCCCACAGAAAAGCGTCCACGTCCTTACGCAGTTGCTCTGGGTTGTACCGACCGCTG
CTGTGGTTAAAGGTTCGAGAATCAAATGACAGTCCAACCAAACGGAAAGTATCAGTTAGCAGGCTTTTGACACGGTCTGCTCTGCGAATTCCAACTAAGC
TGAGGTCGAAAGTTAACGTCACCGTATCCTTGGAGTCGCGGGTAGACAGGATAATTGTTTCATCTCGAAAGCTTGCACACTGCATCGGGGTCTTCAGTGA
AAGTTTTGGCTTTCTCTCCGCTTTGCCATCGGTCTTGCACTCTGATTTACAGTATGACTTGCCAAGTTGTCCTTCGTAAGACTTCCCCGTTGACTCGGAA
ACCAACCAAACATCGAAGAAATCCACTATTGACAAATCGTACGTACGACCAAGGACTTTGAATGCTCCTCCCTTTTCAGAGGAAGTAGCTTGCGATAGCC
TCCCAGTCTTTTCAGCTCTCATTAGCTCTGAGCCTGAACTAATAAGCTCACTGAACTTGTACGAATTCTTGATTCCGAGGTCTTCCGAAGCAGGATCATA
CTTCACATTCATCCCTTCTTCGCCACGAGGTTGAAAGTAACATGTGTAAGTACTCCAATCTTCTGCAGGCCCGACAGTCTTAACTGCACTCTTGATAGCT
ATCTCTGCCGAATGGATTGTTCCACGCTGCTGTTTTGCGTTCGGGTTCACGTAATTCTCATTGCGCAAGATCTCGAGTACAAACCGCAACTTTCCAAGCA
CCCCGTTCGGTGCAGGCGTCTTTTTGGGTTTCGACTTGCCAGACACTACTGGAAGGAGCATTGCCTCCACTTCAACTTGATTTTTGCTATTCATCTTCAG
ATCTTGCGTAGTTGCGTTTCCATTAGCGTCGGCCTGCGTCAATATTACGCCCTTTATGTACCCCGTCTCACTTCGTTGGAATTCAATCGTGACGCAGCCT
AGCGGGTCATTCGCCGAGGTCTTCCCATAGTTCATTACGCGCAACAACATTGCCTTCTTGTCACTGAGCTTAGTTTTCTCCACTTTTCCCAGAAGAAACT
CCTGGTTTTCCCTAAGTGGGGTCGATTTTATGCCCGTTTTCAGACTCGTGTCGACTTCCTTCGAGCTGCCATCTAACAAAATGATCTCCACAAATGGATC
GCTAGTGGCCACAGGTAGCCCACGTCCCTCCAGTTTCGCAATTTTAACAAAGGATGGTTCTTTCCTCACGGCAAACGAAAGCTTCTTCGTTGCGTCTTTG
CTATGCGCCTTGCTTTCTTGCAACTGGGGCGTTGCTGTCTCCTTCTCGGTGGCTTCAGGAATCGGGGCGAACTTAGTACTCCGTTTCACTTCTCGGTTTT
GAACAATCTTAAGCTCCACTCTTAGCTGTCCAATATTTGTCTTCTGGAGCATGTCACTCGCTGGTGCTAGTGGATACCATGCATCGAGTGTACGGTACGG
TGAGATCATCTTCGTATGAATCTTCAAAACACCAAGCGGCTTGTGGCGGTATCTGTGCTTCACCATTCGCGAAACGCAATTTTCCAGGTCAGTGGCCTTG
AACAGGATGTTGAGGTCAGCGCATTTGTCGCGAACTTTTAGTGGATCGAGATCACCTTCGTTTGTCCGGATATGTTCTCTCATGAGGCCTTCCTCGACAA
TCCGTTCGTCACCTAGAGTGTACTCCACATCGTACAACAAGAATATGTCACGCTGCGACTTCGGCAAACCCAACCACGACGCCTTACTATCCACCTTGTA
CTTCTCCAAAAGCTGCTTGAGGTCTCTCGGAACCTCGGTTGTGTTGTTCAGATCGTATGTTGACTTAAATGGGTACTTTTCTTCGGTAAACGGCGTCCGG
ATACGAACAAGTCGTCCAGAGTATAGCGAGTCTTTCTTGAAGTTCACACTGGGTCCAAGCTTGGCTTTTAGATTCTTTCCTTTGCCATAATATGCCATGA
CTGCATCACCTTCAGCACCTGCCTTCTTCAGTTCACTTCGTACTTGAGCCCGCAGTTCTCGACGTTCTTTCTCGTGGTCGTGGTGCGTTAGGCCCCTGTC
GTGACCGAATAGCCGATTGAGCAGCCGATGAAAACTTCCCTCGAGATCGTTAGGGTCGAACTCCGTGGCATGCTTGTTGCACTTTTGCTGTAGAATAACC
GGGTTAAGCTGTTTCATCAATACTTCCTGGCCTGGACGCATATCAACGCGAACGCCTGAGCGCGCTAGGGCCTGAATCCACTTTTGAGCATTTGGAGTTT
TCACCTCAATAACTTTTTCTCTGCCTTTCTGGATCTTTGTCATCTTATCGAGATTTTCAGGGGTCACCAGTTCGAAGTCATTGGAGTCTGGTTTTCTCAC
AGACACCATAGGATTTATTATATCCATCCAGCCACCTTCCGAGTCATTCGAGAAGTTGTAGGCAACTTTACAAACTGCACTTGCCATGTCGATAAAAGCC
ATAGGCGCCATTGAAGTTTCTTTCTCATACATATACAAACGTTTGCGAGCAGGATCTAAAAGGCAGTATCTCCAATTCCACAAAATGTTCTCAACAAGGT
CTGCGCGTCCTTGGCCCTCCACGGGATTTTCACTAAGCTTTTTCACAGATTTTTCAGCAGCAGCGAAACCAACGGTCTTCGCTTTGGTGGGGGATATGAG
AGAATCTTTCCAGCCCTTGACGGTAAACACAATCTTGGAGAGCATAGTATGCATGCCTAGAAAGCCGTCACAGTGCTCTGTTAGCTCCTTCCCGTACGCG
CTTCCTCTTCTGGCGTTTAACTGCGGTGTTTGCTTGTTCGAATTGTTGGCGGTCTTCTTACGGTAGCAATCAATCTCACGAACGATGTCCAGAGGGAACA
AACTCTGCTCACGTGATTGTTTCTCCATCCACATATCGACTTCACGTAAGCGATAGAACCGGTCATCTCTGTTTTCCATTAGCACATGACGCTGGCCAAA
GTCATCCAAAGCAGTAATTCCTGGAGTGACATTTTCAACGAACCCAGCAGCACACAAAGCACTCATCCATTGCAGCGCATGAGAATCACTGGTTGGTGCT
TGAAGCGCATCGCGGTCAAAGTCTAAGTCCTGGTTGCGCCAGCCCAACTTGCACGAGGATAAAATCGCGTCATCGTTACAGTAGGCATCCCACTTGTCAT
CCCACAAAACGGCAGGTTGGCGCCGGAACCAAGAGATGATCCCTTCACCAGTGAAACTTCTCGGGACTAAAAGAATCAGTACACTCGTTTGGTCTCGCAT
GAAAAAGCTGCCGTTCTCTTGAAGAAGTTTCTGCCTGGTAGTACGAAAGCGCACCCATTCTTCACGAGTCATATCATCTGCAGGGAAAACGCGCGGCCCA
GGCACTCCTGCCAAATCCAAGAGTTCATTCTCTAAACCGACGACAATTCCCCTCCGTACTTCATGGGACAACGTGTCCATTGCTCGACCTAGGTGCTGGC
TACCCGGGACAGCATTCACGGTGTGGACGAGACGACACTCCATCATTTCGTCCCGCGAAAGCTTTTCGAACTCCTCGAATTGTCGTATTTCCCGAAGGTT
GCTTACAATCCGTTTCATAATAATGACGAGGACTGTATGCAATGCATCAATCTGAGCATTCTGGGTTAGAGATAGTGACGATCTGAGAATTTGTCGTCGC
TCAATCCAAGTCACTCCCCGAGTGTACAGTGTAGATGACTGCGCCTCGATCTGACATTGTTTCTGGAACCATGCGCTTAAATTGAACAAAGGAGGCTGCT
CAAGTTCTTCTGGCTTAGCGGGCGATTCGCCAATTTTCAACGTTTGTTCGTCGGAAATAGTCGTAAAGCGGACGAAAAGAGTACCTGCAGACTTGTAGAA
TGGGAGCTTTGACGAACTGGGAGGGATGATCTGCAGATACTTGTATTGCTGTCCAGTCCGCAGCGAAGCGAGATCAACTTTCACATATCCAATCGTTTCC
TCCAGATACTCTGCATCTTCAGCGTGGATATCCTTCTTCTTTGACTTTGACTTTTTCTTGCCTGATACCTCGGTCTTGTCATCAGTCTTGGCTTTCTCCT
TCTTGATTTTGGCATCAATTTGAATAAAGATGCTTGACGTCTGCCCAAGAATCTGGTATCCTACCTTGGCTTCATCTGGGTCAATTGCCTCGTAGTCGTA
TTCAGATACTCTGCCAATAACCAATGATTGCTTCTGGAACATCCAGGTATGGCTCACTCTTTCTCGCTGAGAAGCTCTAGTTGTCACTTTGCCGTCCGCT
GACTTGTTGTCTGAAGGTGCAGGATCTGCTGCTTTCTTCGGGCTAGGCGCACCAATATCATCTGCAGCATCGACCTGGGAAGTAATGATAGCTTCCAGTG
GCTGATTTGTCCCCCATTTCCAAGTCGACTTTGGCATGGCTTCTCTTGTAAACAACTCACCCTGGCCATTACAGTAGCAAATACTCGGTTCTTTTTGCAT
TGGTTTTCCAAGAAGCGTTACCCGGCATGAAGGATGACTGTCTTTGTCGAGCTGTTTCAACATCGGAGGTTTTCCCTCTTCCGTTAACAGTACCTGCAAA
TCCGATGCTGAAAAAATCTCGATAACTATGCCTGTAATATGGTGCTGCAACCTTGCCCGTCGCATAGTCTCCTCGTTCACGATATCCAAACGTCTAGCCA
TCAACCTTTCGATATTTTCAGTCAAGCTGTTCACAGGGACGAGTTGGGTGGGCTCCACAACATGCCGTGAGCTGCGTTTAGTGGGATTAGCGTTGGTGGA
TACGTCATTCTCAAGCATCACTTCCAATTGACCATCACCTCGTTCAGCTTGAACGATTCCTTTTACATCCAGAGAAATCAGATTCCGGAAATCATCGATC
GTCTCAATTTCGTCGTTAAAACGAACTTCATATTCGTCTTTTGGATATGGGAAGTATCTCTCAATTCGTGCACGATAAAAGCGTCCGCCATCTTCTCCAC
CACGAAAAGCCAATACGCGTTGTCCGAACTGTAACACCTCGAAATCATCATCCTGCACTTCACCAGCTGGTGAAAGTTTGTGCAACTGAGATCGCTTCAA
ACACACCTCCAATTTCTTTTCCTTATCCGTTAGAAGCTTGGCTAAAACCGTCTCCAGATCATTCTCCAAGTCACGCTCATACAAATGAAGAGACAAATAC
GAGACGTTCGAGATGTCCTTGATTTTCCCGAATACAAAGTTCTGGACTGGCCATGATGGATCTCGAGCGTTGTAGACAGTTAGGCTCTGAGCTCGCTCGG
CTTCTTCTAGTGTTCCGTCACGGCGAACTGGGATGACCGTAAAGTATACGCTAGCTCCATTTTGTAGTCGATGATGCTTCCGCGTCAGAGCTGGGTCCCC
CACAGTAAGATCGAGGTCAGACCCGAGGTTGATCCGGTCACCAGAGACCAACAGATTTCGAGCTTGGTGGATACGCAGTTGAAGGAGTTGAGTTTCACTG
CTCGGATATTTCACATCACTAAATATTCCTGGATATGACAACGAGAGCGAAAACTTTTCCTTTCCCCACGTTGCTGTATTGTCACTGGCGCCGAGCACTC
TTGATGTGGACGTCCTTATTGCAGTCCCACGCTGAAGAACCTCAGCCGTTTCTTCTTCAAACTCAGTTTCATCCAAGTCTTCTATCGTAGACATGCTCAT
CACGTTCATGGAGGGCCCCCTTTGGATGTTGGCCTCAGAAATACTGACATTTGACAGACGCAGCATCAGCTCTTCCAGCGCAGTTGCATTCCCAACAACC
TCTGTTTTAATGCAGAGTTCTCCCAACTCCTTGGCGTGCTTCTTCATCCAGGGCTCCGGTTTCAGTTCATATCGCTTTTCCACTTGTCTTGAATTAATCG
AAGTAACATCCGCCGATGCCCTGCACAAATCGTATAGCGAGATCTCCACTCGGCCAAGAGGGGTACTCTTCCCGATGTTATTGTGATCTTTGACGTGAAT
TAACAGCGAGCTGGCCTCGGAAAGAGGGACATTCTGCGAACATAGCAATAATAACAGGTTAGTATGTTTGGTATTATGGGATGAAAGTACAGAACGTACA
TTCCCGAACACGAAGTTCTCGTTGGTCCACACAGGATTTAAAGTCTTCGAAATCACCGCAGTGCGCTTCTTTTCAGCCTCAATCTCCTTTCCTGTTGTAC
GATCAGTGATAGAAAGTGTGCAATAGGGGTCACTATAGCCGTTCATATCGGCCGGATTGAGCCCGTGTCCTGTCAAAACTTCCACCTTTAAAACTGGAAT
GTCGGGATCACTCTCCAGCGACTTTTCCGATCGAACTTCGTTCTTGGCCAGCTTTTTTCGATGCAGGGATGCTTCCGCGGGGGCCGATTTTGAAAACATG
GCGTTCCGTGCCTCACTTGCAGCTGCTGCAGTTCGTTTGTTTTTCTGTGTTGTGCGCTTACATTCCTCGACACATACGATAGGATCGATCTCGATAACTG
CATACGGAGTAGCTGTGCTTCCTGTGTCGCCAACCTGCTTTTGACTCTGCTTCAGCTCAGATGCCTGGATAACTGCCACCTCGAGCACTGCTTGTCCTTC
TAGACCAACTCGTGCTTGAAAGCCTTCATCAGTTGATACTTTCTCCTGATGGGCTCGCGGAATTTGCGTATTCAGGTAATGAATGCATCCGTTGATGCCG
TAAAATCGCGGGTCGCGCGCCTGGTAGTCGGTCACTGAACATGGTATACGTGCTCCATCCAGCTTGCAAGCCGCGTCATGCAGCTCAAACTGGGCATTCT
CGTAATCACGCTGCTCAATTGACTCGTTGTGTGCTTTCAGGTTAAGCTCTTTGTCAATTTTCTGCCTACGAGCATGTTCCCCGCGTCTCTCGCCAATCAG
CCAGATTTGAAGTTGGATCTCGCCGAGGTTTTCGCTAGTTGACATGCCTTCTTCGGGCAACAGTGTGTGCCACTCAGTCCATTTGTGGGCGGACAGCTGA
TCAAGGCCGATGAGAACGTAACCAAGCGGGTCATGTCGGTCTGACCTGTCGTAATCGATGACCCTCACTTTAAGGCTGGCTGCCGTCTCAATATGACAGA
TCAACCCAAAGACATGGTGCTCGTTAGCCCACGCCGGGTTACGCGTACAGTGCATCGTGGCAGTAGTGGCGTATTCGCCAGGAATTGGCCTCCCATGATC
ATCCAGCAAAGTGAGTTTACAATAAGGATCCGACGAGCCGTTGATATCAGCGCTAATCAGATTCCTCGCTTCTATAACAGTGACCTCCAAGCGGTTGTCA
GTGTGTTCAGTGCTGGCTGTGGCAACAGGACTCGTCGGCACGAAGTCAAGCTCCGAGCTGCGGAAAAACTCATGAAGATTAGGTCCCGATATGCTCATCC
GAACACAGAGCTCTCCCCAGTCCATAGCAATCTCCTCTGTCTCTTGGGAGTCCTTGCGTCGAGGTGGGGACGAACCAGTTTTCTTTGTCGGCTCCACGCG
AAACCATTCATTAATAGGCTCGGACTGGGCCGTACTGGCTGGTGACATGCGAAACCTCGAGAACGGCACCTGTACGAATCCCAAGCTGTCATGCCTCGTG
AAAGCGTCGTGATCCCACAAGTCAAACCGAACCGCCTTCACCGTGTTTATGTCTACTACTCGACCGATTTCGAACGACGCATGCCACGCAGGCTCCAGCG
TCGCCGGAATCACGTCTGTCCGTTTCTCCTCGATGTCGATGATCTTTCCATCCTTGCCAACGAGCTTCACAACACAGTATGGGTCACTTTTCCCGTTCAT
ATCGGCAGCTTTAAGGTTGCGAGCTTCCTCTACAACCAATTTCAGCAGAATACGGGAAGGAGGAGCAGGTTGAGGGGGCGGCTGAACCACCGGCTTCTTG
AGAACGGGTGCCTGCTCTGCTACATCCGGGGTCCGGCGATAAGCATTGGAAATGGCGGTAATCCACTCTTCCTTCTCCACTTCGTTCTCCGCCTGCATGA
AGAAACTCGATTTCCCTGCAGCAGCCTGGAACGTGATGCACAGGGTGTATCCGTGGTCATTGGTCCGAAGTACACTTGAGTCCAGAGTCAGCTCATAGCG
GCGGCGTGGTGCTGCGTCGTGTGGCGTCTTGAAATACACAAGCTCGGTGCGATTCAAGCGAAAATACCTTCTGCGCCAGTTGGCCATGAGTTTGCCTGGC
CGACTGCGTTTCATGAGCCATCCCTCCTTGATGTAGCGTTGGTCACTCATCGCGGGGAGATGTCTTGGCGCGATCGTCTCCTTTACCTCTCCGGTTCAAT
ACAATTCCGTTCTCCTTTGTGGGCTTCTTCGTCTTGTTCGCTGAAGCTCGCTTCTTCTCTTCTGAAGTGTCCGATCAAAAGATCGCGATCGCCTTGAAGC
GTCGTCGCGTCCCCCTGGGCCTTGCACGTTGCCAGCGCTGCGTTGGGCGGTTACGTGATTCTGAGACCATCTTGGCGGTGATTAAGCCATTCAGTTCGCT
CAACGTTTTGGCAAAATTGGAAGGCGCAGAGTTAGTCTGCCGATCCTACGAGTCTATTCTGCGGGGCCCTTTCTGGAAGAAAAGCGGAGGTGGTAATTCT
CGCGGTAAGAGCAGATCTCCCTTGATGGCAACGACCGGCACCTTTAAGTTTTGAGAGTTGCGCCTTGATGAAATGCGCCGCGGACTTGATGCGCCCTTTT
GCGTCATGTTGCACTTATGGTAGAGCACATGACCTTCCACGTTAGAGTACCTGAACTTTGTCTCGATCGACTGCTCCTGTGGAGTGTCATTACTGCTGCT
GTAACTCGCTCGCAGTGACGGCTTCAACTCGACCGCCTCCTCGATGAGCTGGTCTTCATCACATTGAACACCCGAGTCTACCTTCTCCGGCTTCTTCGTC
TTCTCCTCCAGCGCGATTTCTTCGCGTGTATCCATTGATGCTCTGTGTTGCTCTTTCAAATCGACAGCACCTATATCAACAGCAGTCGCAAGCTGCACAA
TTGCCTCCTTCTCAACAACAGCTTCCCCACGTGGACTTATCTGTTGTGACTTGTTCACCTGCACACCCAACGCCTGCTTCAAATGCGGCGCTAGCGTCTT
GCCCAGACACGATAGCGTCACAGTTCCCGTAACTCTCCCAATGATTGCATTGTGGTGGTCCCGCAGCTCCCACGAGCCGTTCTGACTTGCCCACTCACAA
ATACGAAGCAACGTACTGCAATTCGGCAGATCGTCGTCCTGTAGCCCTATATGAAGAGACAAAGGCACGGAGGCGAAGCCTCGAAGCCGCGCTCTACCAT
GCTCCTTGGCGAGCAAAAGCAGCGTTAATGGGAGCTCCACGTCCCTATGCAATTCGTGTGCCAACTCGTCCGGTTCTGCTTCAAAAAGACACGACTTGCC
ATGGCGAAACCTCGTAACTACAGCTTCAGAAGGAGGCGTACAGGCTTCAGGACAGGCCAACTCGGAGTCAAACACGACAATCTCGTACTCTAACAGCTGG
AAGGCAAGGAGGAGAGAGTTCGAAGCTGCTGGGGACGCCACAGGGACTTCTAACGCGACATGGTCGATGTACAGTTGAAGTGAGAACAGTAGAGACGAAC
AAAGCGGCGTTGGAGACGCTCCGATGCTGCCGTCGAAGTCACAGGACGCCACTGACACCAAGTGCGCGTCGCCTTGCGCGTCTTCCATATTTTGTTTCAA
TTGACCATCACTCTGTGGTTTCGGCTAAGTGACATTTTTATAATATGATTGTCTCTACATTTTGTAGTTATTTTTGTAGCAACAAGATCAATTTTCAAAG
TGAAAGCCGCTTTGGATATCACACGTGCGTCACTACCCCACATTCGGAAATCCCAAGCTGCGCGCAATGCTCAGTCGCTTCTTCAGCTCTTCATCGTCCT
CGGCGGCGCACCGTATGGTGCAGCAACACGTCCAAGGTCAAGTGTCGCTGCTTTCCAAGGACCTGTCAATCCCTACTACGCGCGTTGTGTTTGTGTCGCG
TTCGGCTGCTTCGGATCTGCAGTCTTCGCTCCCGTTCCCCGTGTCTGCCGCCGCTCTACGCGACTTCAAGGCCAAGCCGCAGGAGAAGCTTTATCTGTAC
CCGAGTGTGGACGACGAGGCCGTTAAGGACCAGCGTGTGCTGCTCGTGGGGTTGGGAGATGCGGCTAAGGTGACGCCCAATGTGCTACGTGACGCTACGC
ACGGAGCGCTGAGCGCACTCAAGGCCAAACGCGCCAAGGACGTCGTGGTGCAGGTACCTAACCTTGAAGGCTGTAAGCTGGATGCCTCCCGCGTGGTGGA
ACTGCTGTCCCAGGCTTCCATACTGTCCAATTACCAGTTCGACCAGTACCTGACGGATTCCAAGGACACTTACGGAGACAGCAAACTCCGTTTGCCCCTC
GAACAGATTTACTTGGACGCATCAGCAGAGTTCCAGAAGGTAAGAGAGTGTGGTGGCCAGAAGGTGATAGCGGAGACTGACGCGTGCTTGCTGTAGAATG
TGGAGGAACAAGCGACGGTGGGCGAAGAAACGATTTTCGCACGCAACCTTGGTTGGTAGCTGTAGTAGCACTATGATGAGTACTTTTAGTTGAGTACTAA
CTGTATCTTTGTTGTTGTGCAGGCAACGAACGCTCGCACATTGCGAACCCGGCCTTTATGGAGGAAGTGGCACGCGCGTCCGCCGACCTTCCCAACATGT
CGGTCCGGGTGCTGCAGCAAGAAGACCTGGAGAAGGAGGGTATGAACATGTTCCTGAGTGTCGGCCAGGCTGGAGTGTGTCCTCCTCGTCTTGTGATTCT
TGAGTACCGTGGCAACCCGGACTCGGACAAGAAGGTCGCGCTGGTCGGTAAGGGTATCACATTTGACACGGGCGGCTTGAACCTCAAGCCGACGGGCTCC
ATCGAAGACATGCACACGGACATGTGTGGTTCTGCTGCCGTGCTTGGTGCTGTTCGTGCCGCTTCTCGCCAGGGCCTCAAGGCAAACATTGTCTGTGCCC
TCGCCCTGGCTGAGAACGCGATCGGATCCAAGGCCGTGAAGCCGCTGACGATTGTCAAGTCGCACAAGGGCATCACTGTGGAGAACAACAACACGGACGC
TGAGGGCCGCCTGGTGCTTGGCGACGCGATGTCGTACGTTCAGAAGGAGTATAAGCCCAAGAAGATCATCGATGTAGCTACCCTTACTGGTGCGTGCATG
ATCGCTCTGGGCGAACACTGCGCTGGCCTGTTCTCAAACTCAGACGAGTTAGCCAAGAAGCTGCAGCAGACTGGAACGGAATGCCACGAACGCTGCTGGC
ACCTGCCGATTCTTCCCGAGCACACTGCGGCTCTCAAGGGCTCACAGTCGGACTCCCGCAGCACTGGTCGCGGTCGCTATGGCGGTGCGTCCACAGCTGC
AGCTTTCCTGCAGCAGTTTGTGTATGAGGGTGTGGACTGGGCCCACATCGACATCGCGGGGCCCTCGAACTACAGTGCTGCGAAGTCGTATTTCCCTAAG
GGTGCCACGGGCTTTGGTGTCCAGCTGCTCTACACCTACCTGAAGGAGCACGAGCAGCATTAGAGGATTGGTGTGTCCTGTTACTGAGCACAGTGTCGGG
AGCCCTGTGAATTTATCTGCGTCGTGTTTGTTGTTACTCAATAGAATGGCAAATATGAAAGGTATGTTGAAGTTATTGGCTGACTACTGCTCCGTGTACA
GGTTCCAGACGAAAACGCAGCCGTCGTCACCCACCGAGATTAGCTGTCGATCATCCGGGCTGAAAGCTAGGCCACGTACATTTCCAGAGTGACCAACGCC
GTCCATGATTAGCTGGTTGGTGCTGTAGTCCCAGAGTTTCACGAGTCTGTCGTTTCCACCAGTGGCGAATACCTCGAGACTGTGCGCTACCGCAATGCAC
GTGGCTTCTTCCTCGTGGGCCTTCTGGATCACAGTCACTGGAGTGTCAATGCGCAGATCCCAATACGATATGCGTTTCTCCTGGCCGGCACTCAGAACAA
GACGCTGGTCTGAAGACAGCGTCACGGTGTTGATCCCGCCCATGCGCTGGATGTGACTCGAAATCCTGCGCTCACTGCGTAAATCCCAACACAGTAGATT
TCGATCTCGACTGCAAGAAATCACGTGCAGGTCGTCCCTATACAGCGCCAGACTCGTGACGGCCATCGAGTGCTCCTTCAGGTGCGAAACCAAGTCGCGT
TTGCGAATATCCCATACACGCACTTCCCCTCCAGCTCCGGCAGACACTATGAAACGCTGGTTATGGCTCAGAGCAAGTGCCGTGACTCCACCAGTGTGGG
CATTATCAATAGACCAGGCCAACTCGCCAGAATCGCTGCTATGAGAGCGAACACACCCGTCAGTCCAACCAGAAATAAGCACGTCCAGCGAATACTGGAG
GGATGTCGGGGCACCGGCATCGCCAACGAAGCAGCGGGTCGCAACGGTGTAATCCGAGGCGTCCCAAATGCGAATTGTGCAGTCCCGAGAGATGGTAGCG
AATCGATCCGATGCGTCCGGGGCGTAGGCTATTTGCACGACAGCGTTCGAGTGGTTTTCAGACAGCAAAATCGCCTTCATAGTGCGTTGCGACGTGCCAA
AGTTCAGACGCACCGAGAAGATACTCCCAGCTTGCGTGCCAGCGACGGCCTCATTCTGAGCAGCATTGAGAGTCAAACCGACAACGCCGCTGTTGAGGCC
TACATGGCAAGTATCAACGAAGTCGTGTCCGTAGTGCAGGACGCTTCCATCGCCGCCACCCACCAGAACGCCGCCATTGTAGTACAAAATCGAGTTGACA
CCGCAGGAACACGCTGGAACCACCTTGAATAGCTGTCGGGTCTTGACGTTGACGACGCAGAAATCACCACTTGAACTTCCAGCCACCAGAAACTCCCGGT
CGGGAGAAAACTGTACGCAAGTGTAATCGCGAATGAGTGTCTGCTCGATCTTGTGCTGCGTGAGCTCTCCGGTGGCTGGATTAAGGACCCAAAGCTGCAG
CAATCGATGTCCAACTGTTGCAAACTGGTAGTTGGCTGTGTCTCGGCGCTTTACGTCACGCGCCATCCCTCCGAATGCAACCGCAGTGACGATATTTGCC
ATCTTCTGGTGCGTGGCACAGATATTCCCCGTCAGAACGTCCCAAATGTACAGCCTTGGTCCGTCTCCTGGCACTCCCACAGAGCATAACAGTCGTTCGT
CATCCGAAAATGCAAGAGCAGCGATGCCTGCGTCATGTTCCGACAGTCGGAAAGCGAGTCTTCGAGCGGAATAATCCCACACGAGGACATCCGCACGCCT
GCCGCGCTCGCCCGAGGCTAGCATCCTTCCAGAAGGTGACATGGCGATGCATGACACATTGCCCTCATGGCCTCGCAGGAAAAGCTGACTGTGCGCGTCT
TGAAACGAAGTAAGCAGCACGGATCCGCCGGCAGGATACACATACTCTCGTCCGGACGGATGATAATGAATGGCGTTTGGTACTGCAGAGAATCCAATCG
TGTGCTCCAGTTCAATCACGGTGGTGGATTGCGGCTGCTTGTCGAATCGTTGGTGCGGGGAACTCGACGTTGCAGCGAATCCTCTCGACTTGGGCTTGCC
ATCCATGACCGGAAAGTCTTCGTATCCTCGTGCATTGTTGTCACCATCGTACTGCATTGTCGATAGCGAGCGGCTTCTTGGCGATCTGAAGGGGCCACAA
CAGCGACCGAAAGCGAAACGAAACCACTAAAACTAAACATAATGTTATCCCCAAGTTACCTCACTCATGGGCTGCCCCAGACTCAAGAAGCCCCGTGACG
CCTACATAGCTCAAACACGTATAGTACGGAGGAAGATTGTTCTCCTCCATCCACCGGGCTACATCAACGCCGATATCTTCCTGTCGCTCGAACAAATTCA
ACCTCAACACGCCTCGAGAGAGAAAAACCCGGCACGGGAGCTCGAATGTCTGCATCTAATCACGCAGAGATAACACAATACATCACACGTCAGTTTGGCT
GCAGTTAAGATCTTGTAGGCACCTTAAGCCTCGGCACCTTCATATCTTTGACAATGTTGAATTCCATCGACTCGTAGACGAGCATTCCGGTCTCTCCATC
ATCCCCAAGCTCATAGAGCGCAAAGGATACTCTCTTTGGAGAGTACGTGGGACTGCCAGGATACCAGAAGACCCGGTAGGGCACAACCTGCACGCTGTTC
ACGAGGCAGTTCTCCAACAAGTTGTAGTCCAGATAATCTATCGTCGAATGTCCCCAAGTCGAGGCACTACAGTTTAAAACAATCGTCAATATCTCTCCAG
AAATCCTTCTTCAGCACCTTCAGTACCTGCTCCAATAGCACGGCCGTCCTCTAGCACAGCCGCATTCCTGCTGCAGCCTCTTGGCGATGGCCTCAAAGGC
GAGTGAGTCGTCTGCCACCACTGTGTTGGTCAGTAACGCCACGCCAATGCCGCAGTGAGACCTGGTCAGCGTGTTCTCTGCCGACTCGTTCGTGTGATCT
ACCGACGAGCACTCTGCAATTAAAAAAAATATTAGAAAAATAAAAATACTATCATACTCAGCATTTATCTTCTATCGACCTCGGACTTGACGTAGCATGG
AGAGTTCCTCGCCCACAGGGCTATGAGCCAACATCGCTAGACGTTTCCAGTCAGCAGAGCTGCGGCTAAGACTGGAGTTCGCATACAGAGCGGCATGCTG
CGCCAGGATCCGCCACGAGCCTTAGGAGAAAGAGCGGAATCAGATGAAGAAGCAAACAGGAGAACGCAGGGGACGCACCGCAATGGACGATGATGTCGCG
TATGTGGCGGTTGGTGGCCTCTAGATGCAGCAGACTCGCGTGGTCTGAGAACTGCAGCGTTGCCGCCAATAGGTCGCTAGGCAACTCGCACAGCCCCATT
GACTTCTGATTCTCGAGTGATCAGGTGTAGCTTCTGGGCGACAAAAGTTGAACTTGCAAATAATAGCCGCAGATCTCCTAAGATTTAAGTCGGCAAAGTA
TCAGTTTTTAATCAATAACTTAGGACATATGCCGTCCTAACTCTTCTTCATCTGCACACTGCACAGCTCTGCAATGGAGAAACTGTAGCCTAGTCATCCC
AGCGGTTCAGAGCCTGACGAAGCATGCGCTGGAACTGCGACGTAGCGGCCCGTTCCTTCTCAATCTCGACTCGAAGGCGCTTCATTTCGCCTACCGCCTT
GTACTTCTGCACTGTAGTCACCTCCCCAAAGCTTCGTCTTACACTCCTCATTGAAACCTGCACCGGTCTCTGCTTCACTTCAACGTGTTTTTGCATGGCG
CTCTGACTCGAACCCAGGAGCTGCTTTGGCGTCGAGTTATGCACAGCGTCCAGCAGCCTCGACACATTCGATCCGAAGCTACGCCAGTCCGCCGGGTAGT
AAATGGTGATGTCGTTCAGCGTCTCGAAGAACGTCTCGTAAATCTCCTGGAAGATCTTCTTCCACGGCAGCAATGTATTGGCCTCTTGCGGTGTCACCTG
ACCAGTCTTGTCGTCTTGAATTAACCCCTCGTGGATTGGAAGAAGAACGCAGTAAATCCGCTTCTTGAGTTCGTACGTCGACACTGCAGTGGCGGCTGGA
TACAGCAGAAACAAACGGTCGATAAAATCCTCCACCTTCTTGAAGTAGACGTCGCATGTCTGGTCGCGGTTCGTCGGGGAGGTCTCGACAACGACCCGAG
TGACTTCAAGTGCCGTGAGAATCGTCCTGATCTCGTGTCTCCGCTCCTGGGAGTTCCAGCCACGCGGAGGATCCGCAACAGCAAACTGCAGCTCCGGCGG
CGGGAACGTCAGATCCATTACACCGGAGGACAAAATGTCTTGACGTACACGCGGAAACACAGCACAAATACTGTCCTGAATACCAACTGACGATTCGAAC
TGGTTCATCATGGCCTTGACACTTCCCTCTAGGAGCTCCTTCAGTCCGACGCTCTTGTGATGGCGAACAGGAGGAGACAGAGCCGCAACCTTCTTCAGCA
CTTGACCGAACTTTTGAGGCAGAAGAACACCAGCATCGAGGATCTCAGTGGCGACGTAGGCCACCTGCGTAGCGAACTGGCTTTGCACCCGTTCCATATA
GCCTTCGAGTGTGTGAATTAGCGATGCCCGTGACTTCTCCACTTCCGCAGAGGCAAAGCCGACTGCAAGCACTGTCACGCGGCATCCTGCATTCAACGAC
GACAGAAGCTCACCGAGTCGCCGCTCAAACCTACTACAACTGTCTGCTTGATCCAGTGTACTGATGTCAACTGGTAGTAGAATTACCGAGGTTGCAGCCA
ACTTGTTCTGTTGAGCTTCGGGTGTGTACCGATGAAAGAACTTCGAATCCAGATAGCGACTGCACACAGCAACTCCCTGCGCCACCCCGTTACACGAGTG
GAAAGTACGATGACAGTCGTTCTCAGGCTTCGAGACATCCTGGGCTCCTGCCCTGACAGCGCACCATAAACCGAACGATGAGGAAGCTCCATCTAGTAGA
TCTGCTATCACCAGTTTCCACGCGATTGACGGTGCGTTGGGGTTTTGCTGGCGAAGAGGTCCACCAACCACATTCAGTATGTCTTCAGAGCTCCAGAGCG
ATAGTAGTTCTTCATCCGAAGGCGACACACTTTCTTCTGACATAGGCGGTTGCTTTAATCGCCTCGTACCAATCGATGAACCAGAGGCCCCATTCGTTCC
TCTGAAGAGCCACTGCAAACTGTCCTTTGCCTTTTGATGAGGTTGATCAAGTCGAAGCTTCGAGGCGATGGAAACTGGACCAGGACCATTGCGAGACATC
TTAACATACTTCTTCCACATGTGGAGTTTCAGCTTCAGAACGGCAAGTCGTTGCTTTTCAATGCGGCGTATCCTCTTCCTTTCTGCCCGCTCCCTTGCCA
ATTGTGCTTGTCGTTGCGCTTCGAGGGCAGCTTCACGAGCTTGTCGTGCTCGCTCCTCTGCTAACTGTTGCTGACGCTGCCGCTCAAGCTCTTCGGCTTG
TTTCCGTCGAAGTTCTTCCTGCCGTTTTTCTTCTTGTCGACGTCGTTCTTCTTCAGCAGCCTTTATCCTCATAGCTTCGGCTTGCTGCAGCGCGGCAAGT
CTCTGCCTCTCTGCTTCGCGTGCGGCTTCTTCAGCCTTCCTGCGCTGTTCTTCCAGTTCGCGCTGTTTCTTCTGCTCGCGAAGCTGGGCTTCTAGCGCTT
CTTGCTGTTGTTTTGCCTCAGCGGCCTCTTTTTCAGCTTGAACTCGAGCAAGAGATTCTTTCTTCGTTTGTTCTTCACGCTGAGCAGCCTGCTCATCAGC
AACCTTCTTCGCCTGATCATGTCGGGTCTTCTCCTCCTTCGCTCTCTCCAGCTCCCGCATTCGCTCTAGCATTGCCTGCTTTTTCTGCTCCAGCTCTCTT
TTCCTCTGCGCAATCGCATCCAGCTCGTGAATCTTCTGGGTTGTGCCAACTACTTGCCGCTGGGTCGAAAAATCGTTCGCATGACTAACTTGAGCATCCG
CTGGAGGCGCCACGGGAACTCCTTCGTTGTAGTCAACGAAATACGAGTAATCGTCCTCATACGGAGGCCTGTCAGGGTACAGTCTAGCCTGTTCCTCCCG
TTCAGAATCTTGGATCAGCTTGCTAAGAGCTGGGTATTCATCTCGAGCATATTCGGTCACGCCGCGACAGATATCTCGTCGTAAATAGTTGCTGTACACA
TCAACGAGGTCGGTGAGAATTACTAAGTTTGTACACAAGTGCACAAAGATGTAGGCATACCCTTGCTTCATTCCAACGTATATCTTGGAACTGTGCGTTT
TCAACGGCGTATTGTTCCGTCGTAGCTGGACATCTGCAAGATAGTCAACACACAACAGTCACTATGTGTGCCACAACATGCAACACCGTAATTTCAAACA
GATTCGTACCAGTTTCGAAGTCACCGCCGAATTTCACAATCATTGAACTGTCGTCACCAGTGCCAGGCCTGCCAGAAATCCTGAGTTGATGCTCTTGGCA
CACGGAGTAGGCGTGCTCAATGTCATCAAAGCATAGCAGCTCGACCAAGTCTTCTAGCGGATAGATCTGACTGCGGTAAGCACGATTCATACGAAGCAGA
GCCGACGACCGGACGTTCGGGATATACCGGAAGAGCAGACATGACTGCAGGTAAGTCGCTTGGCGGAGCAACGAGAAGAACTGGAAATAGTCACCGGTAT
GGCGAGCTACAAACACGCGCATCGCAAACTTCATGTGCGGACTTTCCAGAATGTGGCGCGGGAGATCCTTTACATACTTCAAGACGTCCATGCCTCGACC
ATTATCCAGCGTACAAAGGATAAAATACGCTCGACACTCAGCCTCGAATGGGCTCATATATGCCGGATCTCCCACCTTGTAACTTTCATCGTACAGTTCG
TTCAGCGACTTAAGAGTTTGTCCAAGTTGTTCCATGTTCTGCTGAGCCACGAAGCTTGGAGTTTCAATGAGCTCATGCTCACTGAGAACGTGATAGCGTG
CAATACGCTCATGAATATCAAGAGCGATTGGGTGCACTCGACCGCCAGCGCCACGGTAATTCTGGAGCACAAAGTCTTTCCGGATCATTCGGAACCGGTC
CCAACAGAAGTTGTACAGCTCAATAGGTTCTGGTACTCGAGGCGTCTGAAAACGAGGATCTGGCCCACACTGGTCCAGATCCATGATGGCCTGCTCGATA
TACAGCTGAGTACGCCGAAGAACCCCAGGAGGCCGGATCTCTTCCGCGATATCTAGCTTGTGATCAGCTGAGCTGCGCTGGAAACGCTTGATAATCATGT
CACGCTCACTTCCTGGGCGATCAGGAAAACACTTTTCGAAGACGCTTAACTCATCCACTCGAATATGCAGCTCTCGTTCTGCCGGGCTACACATATCAGC
GCAAAGGCCATCCAGATTTGTAGCTGCTGACAGCTGAGCTTTGCTGTTATCGTCTCGAGATGAAGAGGCTGCAGACTGCATGGGGACATACGAAATCTCT
TCGTCACTTGTGCTTGGTGCCTTTTTCTTCTGCCGACCTTGGCGATGTTTCCCAGGCTTGTCATGTGTTGGGCTTGTCTTAGGTGTCGCTGCAGCTCCAA
ATGCATCACCACTTGGAGGAAACTTGTTTCTAGGAATGATGTGCTCTCCGCCAAAGGGATTCCCGTCTTGTTCCGTAAACCCTTGATTTTGTTTTCCCTT
CCCAAATGGGGATTTCTTTGCGCCACTCATCCGCGCCTCCATTGACGCCATCTTGTCCGAATTAGCGAATCCTCCTGAACTGTCCGAAACAGACTTTGGT
GTAGATTGTCTTCGCTTGTTAGTACCCCCCAATGTGGTGGCAGGAGCAGCACCGCCAGGAGGTGAGGGCTTTCCAAATGAGTTGAAGGTGTTACCGCCCG
ATGAGTTTCCAAATGTTGTATGGATAGTTGGACCGCTTGAAAAACCACCACCACCGCTTCCTGGAGCAGTGAATGGATTATCTGCACGTCCAGAAGAGGC
AGATTTAGGAGTGATTTGTTTCTTCCGCACCTTCACACCTGACGCCTGGCTTCCAAATGCTGTGCCTGGTGACGATAATGGTGCTGCTCCAGCATTTCCA
GGTACAAAACCGATGGAATCTTGCGGGAAAGAACCCTGCCCGCGCTTCGACGTAGGGGCTCCAAAGGCAGTCTGTCCGCCACTAAATCCACTGTCATTGC
CACTGAACGTCGCACCGAAAGACGTTGATCCATTGCCACCGAATCCAGAGCTTCGATTCTTGGGCTTTCCACCAGCATTGGACGCAGATCCAAACGTTGT
ATGTCCACTGCCTGGATTTGAAGAAGGAAAGGCTCCATTCTGTCCGAAAGGGGTCGACCCGAAGGTCGTACTCTTGTTCTGCTGTGTCTTCTTCTTGCCA
CCGCTTTTCTGTCCGAACGGATTCCCACTGGATGCAGCTCCATTAAATCCCCCCGGTTGCATCGGAGGGGCTCCAGCCAAGCCTCCAGGAGGCAGAGGTG
GCTGGTTGCCGAATCCTCCCCCTGGAGCGCCAGCCAAGCCGCCCGGAGGCAGTGGAGGCTGACTGCCGAAGCCAGAACTCTGTCCGAACGTCGTCTTGGC
TGCTCGACCACTGCTACCAGTCTGGAACGGGCTCACGGCCGTCGTGGATCCTGAACAATGCGAAGGCACCGATCAATATCTGCAGAATGGAGCGCTATAG
TGTCGCAAGCGAGAGAGTCGACGTCCCGTCCACCTGCACTGCATGCCCTCATAGCAAAATAAAGTAACCGTAACCCATGTAACCTTCCGTACCTTGATTC
TGTCCGAATGGTTTGCCGCCTTGCGCCCCGAAGCCTCCGAAGCCGCCGCCTCGATCTGCACATGATGGCAAAGATGTGTCAGCTCATAACTCAGCCAATA
CGGGGTCACCAGAAGCGCACGACGGGTGTATAGACAGCTAATAACATGTAGAACGTACTACCGGAGCTGAACATCGTAACCAAGTCCACAGGATCTGTAT
GCGTCGGCGGAGAAGAGGTCGTCCTTGTTCGGTCACGTAGCCGTTGGGGAAGCTGAGAGCTGACTGTACCCCTTTGAAGCGGTATACCGGTATAAAACAG
GTAGTCGAAATTAAGGTTTACATCGTATATTTGGAATCATCCTAGTTTAGGTCAAATACTACGATATGATTGGCTGTTGCCACGGAGTATAGTGAGTCCA
AGTCACTTCGAGGACTGGAGCCCGCTGCGCGTTGGGGAACCACCAATTCTCCCGACCCTTGTCCGCTGGCTGTTTGTTGGCTCCAAGTTCCAAATTGCCC
GCAACTTTCTGAGTAACTTCGCGCGAAGGTAAATGCTCGGGCGTAGCTGGTCCCTCCCTAATGACTTGAGCAGACACGAAGACTCACGTGCTGCCTGTGT
GTGTGTGTGTGTAGTTGAAAGATGGTGAAGCACAACAACGTCATCCCCAACGGCCACTTCCACAAGTACTGGGAGTCCCGAATCAAGACTTGGTTCGACC
AGGTACGATCCAATACAGTTATTCAGCTACACAGCCAGCCACACAGCGACGCGTTTGGTCTCTCCGTTTGAGGCGTAACAGGTCAACCAAAACCAGGAAA
CAGACAGTAAATTCATCAGGTTGTCGGGAGTGGAGAGACCAACAGGACCATTTGGCTGGCTGGCTGGTTGCAGCGATAATTAAGAGAGTAGGGCGCTGAT
GTCCATTGTTGTGCTGACCACTACAGGCTTCCAAGAAGAAGACCCGCCGTCTGAGACGTAAGGCTAAGGCCGCTGCCATCGCCCCGCGTCCGGCCGCTGG
TCTGCTGCGCCCCGCTGTGCACTGCCCCACGATCAAGTACGGCTCCAAGGTCCGTGCTGGCAAGGGTTTCACACTGGAGGAGCTGAAGGAGGCTGGCATT
AACCGCAAGCAGGCCATCAGCATTGGCATTGCCGTGGACTTCCGCCGCACCAACAAGTCGGTCGAGTCGCTCCAGGCTAACGTGCACCGCCTCAAGGCCT
ACAAGGCCAAGCTCGTGGTGTTCCCGCGCAAGAGCAACAAGCCCAAGAACGGCGACGCCGCTGCTGAGGACGTGAAGAACGCCGTGCAGCACACCGGCGC
GATCCTTCCGATCACCCGCTCGAGCATCAAGTCGACCACGGCCGTCATCACGCCCGAGATGAAGGAGAAGAGCGTGTTCACGCAGCTGCGTGTGGCTCGC
GCTGACAAGCGCATCTTCGGCAAGCAGGCCAAGCGTCTGGCTGACGCTAAGAAGGAGAAGAAGTAAGTGTCGTTCGCGTCGACATCTACTGGCCTGATCT
CTTGAACGACTTGTTTTCAGGAGGAATGGCGCTTCGTAAGGTCATTTGCGGAAAATTGGAACACAATACATCGCGCTTCAAAAACAAACATCTCTTCATG
GCTTGCCTGCGTGCATGTAGCTGTAGGAGAAGCTTCGTAGATGATCTTGTGGCAACTTACATCTAGCTCTGTATTCATGATTCCTTTTCACCTTAAATTT
GGTAATTCTTGCGGCATGAGTCTTCTAACTCTATTCACACTCGCACGTCTGCATAGGCTTCAGGCTCTGACAGCAATGGCTGCTTCTCTGGTTCGTCTGG
AGTCATTGAAATGGACTTGAGTTTCACCCGACCTCCTCCGACACTTGTGCTTTCGGACGTGTCAACCTTCTCCGGCAATACGTTCAGGAAGACCAACACA
AGCAACTGGCCAACCGAAGAAATCACTACAACCAGCCAGAGATTGTCCCAATCCACAACCTTCGTGGTCGGGTCGGGTACAATGCCCAGTATCGACACCA
CAAAGGACATGAGCACTCCAGACACGACGCCCCCGAAGTCCATGAACGAGAGATACAACGCGTACGTGAGTCCCTGAACTTCTGGATGGGCTGGACAATA
GTAAGTGGCCACGACGAGCAATTGTAGCAGCGCGAACTCCGAGGTGAAGGACGTGATGAACGACTCCGCCGTGCCGAACGTGCAGACGGAGACCGGGAGA
TCAACGACAGGAGGAGCCAACAGCAGTCGGGGCAGCCCAGCAGCAACGGAAGACACTGTCGATAGAAGGAAGACACTTCGGACGCTCTTGTTGGCGCACC
ACTTGGCGTACGACAGACACGAGAGGAAGCGTCCGATCATGCCTGCCAGGTACATGTACTGCAAGCACTCGTGCTCGTCATTGAGGAGCGAGTACGTGTA
CTGATACCAGACCGTTCCATCGTTGGGCAGTGCATTGCACAGGAAGAAGAAGACCATAGGCGGGAGGACGGGCTTGATAAGCTCCATTTTGTGTAGCAGG
TCTCGCTTGAACGGCAGCCACCACGACAATACCGTGTTTCTCCACGATGCCGCTGCAACCACGTCTCCAATCTCACCGGAGCGTTCCGTTTCACTGCCTG
CAAATTCAAATACCGGCGTTTCCTTCAGTCCAAAGAAGCACACGCCCGCTGCTGTAAGTGGGAACAAGCTGCTCCAGCCAATGACTTCCTGAGGTGTGAT
GTTCTTGTCCAGATACACTGGGATGCCCAGCACTAAGGCCATAATAGAAGCCGCGTTCTTCGTCCCATTAGCAAATGACTGCACGCGAGCGCTGCTTCTG
CTTGTAGCGTCCCCCGTCGTGAGGTTCACTAGAAAAATGCCGAGCATCATCTGCGCGAAAGCTTCAGCCACTGCGTCCACGAGTTTTACGATGAAAGCTC
CAGCGATGGAGTGCACGTACGTGGCTGTAAGAACCAGTGACGTAGCTGCACATACCTCGCAGATGATAATGTACGACTTGCGGCGGTATCTGAAGAGCGG
GAAGCTGTCGGACAGAAGGCCGTAGAGAGGCTTGAGGTTCCAGGGGAAGAAAGTGACCGAATAGTACAGCGTCGTCGTGGCTGGTGGCATGTGGATGACG
TCAAAGAGCCACGTACCGTACGCCGTCGTTGGGAACGTCATGCAGAAGGCGTGGAGGAAGTACAGCGCCAGCAGCGCCAGTGGCATCGGAGCTGAAGCCA
TCGCCATTACTAGTATGCTCTGCCGTCTGATTCTGGCTAATCAAGGACACATTACCACGAGTACTTAACTACATCGATGTTGTCCACGGTACGATATCGA
TTTTTGATTGGCGCTGATTCGTTGAAAATAAGCAGCAGCAATTGATACAGACACTTGACCATCGCCTGGTGCAGGACGCACGAAGACTTGAGGACTTGAG
GACGTCATGGCGCGCGACGAGTTCAACATCGACGAGGCGGATGAATTTGACGACGGCACGCGCGCTGTTCTTCATGATGACGCGTCGGATTCAGCCGAAG
AGACTCAGGACTCGACGCGTCTGCGCTCGTCCCGCAAGCAGCGACTACAGGCAGGACGCAAAGGCGGCAAACAACGCGAGCAGGCGTCGGCTCTGCGTGT
TAAGAACTGGGACGCTGGGTTGCTGGAGACTGAAGAGTATGCAGGCAAAGTGGTGAAGCGCAAGGATCTAAGTGACGGCATGGAGTCGCCTGACGAGGAC
GCGATGGCTCAGTGGTCGGACGCTGAGCCCTTTGGAGCTTCGGATGAAGAAGAGGAGGAAGAAGAGAAGAATGAACAAGAAGACGAGAGTGAAGAGGAAA
GTGATGAAGAGGACAAGAGTGCCGAGATGCTCATCAGAGGCTTCCAGAAGGAGGACTCGGCGAGACTCATGGGCGCTCAGGACAGCGAGAAAGTTGTGGA
GAAGGCCAAGCACGTGCGAAACCAGAAGCTCGTTTGGGAGCGCTGTCTTGAAGTGCAGATCTACACAAAGAGACTGTTGACGACCGCAAAGGATGCCGCG
AATGAGAAGGATGGAGAGACAACTGACGAAGACACAGCCACGAAGACGAAGGAGAAGGTGGTGGCTGAGCTCTACAAGAGTATCGATGCTGTTTCGGCGC
TGCAGGAGAAGCTGTGCAACGTCCCGGAGTTGAATGCTCCTGACAGTCCGACGAAGAAGCGTAAGCGGACGTGTGACGAGCTGTGGCAGGAAATTACTAC
CAGCAACCGTAACATGCTCCCTCAGTACAACGACATTCTCAACACATACACGCGCAAGACAGATCTGGCGGCGGGAGGCAAAAACAACCAAGCAAAGAAG
TTCAAGGCTGTGAACCAAGACATCCTGGCGCAGGTCGAGTCGGTCCTGGTTGACCCCCAGCGAGTGAAGCGAAAGGCACACGCTCCATTGGATGTACCGG
AGGCTGAGGCAACAGAAGGACCCGAAGATCTGCTGGACGAGCTCATGTACGACGACTCGGACTTCTACCAGCAGCTTCTGAAGGAGTTTATTGAGAGTGG
AGGAGGTGGCGCTGGTCAGGAAGCAATGGTGAGACGCACTCACCGCAAGAAGAAGAAACTCGTCAACCGCAAAGCCAGTAAGGGCCGCCAACTGCGGTAC
ACAGTTCACCCTAAGCTGGAGAACTTTACGTTCCCGGAGCCGTACCCGCAGCCGGAGATGGACGTGACGGAGCTATTTCGCTCACTCTTTGGCCAAGTCC
GGCAGTAGGCAGCTTTAATTTGACACGGGAGCTGAAGAATAGACTGATGATTTGATCGTAAAGTGCCTGCTTTGTTAGCATGCTTAGAGCTATGCCTTCT
TCTCCTCTACAGAAGATGTAACGCCAGACTTTAGCGCCGCGTTGTGATCAAAGGAAGACACCTTTAGTTCCCTTAAAGCACATCGTCTTCTTCCTCCTCT
TCCTTATCGCCTGATAGATACATTTCCTTGATCTTCGCTAAAGTAGCTTCCACCTCCCGAAGCCGCACCTCATTCACTCCCTGGGATCCGATCTTTTTCA
CAATGCCGACCAGTGTCACCGCCTTCTCAGCAGCATGAACCACAGCCAGCGCTCGGATTTTCTTGGCTCGGGTTGCATTCTCAAGTGACCGGAACTCTTC
CTCAGCTAAATCCATGGAGGCGTCAGCTAAGACCACTGCAGAGTCGATGAGTTCTGTGCCTCGCTCCTCGAAGCGCTCTGGGATGTTGAACGTATGCAGT
TGCCGCACTTCCGCCGCGTACGAGCCGCTCTTAAATACTTTGTGTTTGAGCTTCACCGTGTCCTTCAAGAGCTGCGTGAACTTGTCGATCAATTCCGGTT
TCCCCTTAGCAATCGCACGCATTGTGGCAGGCGCGTTTATAATTTGAGCACGCTTTGCGATCAACTGACCAGCATCACGTTCCAAAAACGAGAGCCCCCA
CAGCCGTCCGTACGCTTTACCAGCATCCAGTCGTTCTTGCTCGGAGAAATACCAGTCTCGTGTGTCCTTGTTCTTGATCAGGAGACGCGAGGACCAGGTC
TGAACCGAGTCTGTGCCGAGCGCAAGCCCAAACTCTTCTAGCTTTGGAGCAATCGTTTTGTAGAAAGAGATCGCTTCTTCGTCAGTAGACATCGTCGTTG
TCAGGAGCTCTGCCACTAAGCGATTTACTTCGTCGCGGTTCTCCACAAGCTTCTTGTTGCTCTCCTTTCGCGCTTTCTTCTCCAGCTGCTCGATCATATT
CATGCCGCCAGGACCTTTCGACTGGTGTGACTCATCGCCAAAAATGTCGTCGATAGCACTCTCGGCTGCAGCTAACTCCTGAGCCATTTGATCTTCTACT
GATCGCGGTGGCATACCATCTACAGCTCCGCCACCTCCGCTACTGCCACGACCACGAGCACCACTTAAGCTTCCGCCATTTGATACTGTACCAATTGCGA
TCAAGTACATTGTCAGTTCAGGATCACATTACTCCAAAATTACAGACACCACCTCACCTTGCTGGATAATCTGCTGGTGTTGCATAAGGATGCTGAAAAG
CTGCTCCATTGAGACCGGCCCTGTAGGCGACGCTGGGGCTTGAGCAGGTGGCTAATGAGCACAGCAAATAATAAAGTTAGCAAAATGAAAAAAAATGCCA
TTGGCGCTTCGCAACTTACACCAGGATCGTTAGGAGACACATCGTCTGGACGATCAAGCATCTCCGGGTCCACCTCCTCTGCCTTCATTTTCAGCTTGAT
CTGCTCATCAGGCATTCCCATTTGACGCAGCTTGAAATACTTCTGGAACTTCGGGTCATCTTTGACATAGAGCGGATCGTACGGGACGACGGGGGCAGCA
GCGGGCAGTGAGGTCCAGTTGAAGCCCCCGCTCGCTCCTTGCAGTGGAGACGCCATTCCGTTTGTCGGATATCCGGCCGCGCCTTGGACCGGCGGCTTCA
TATCATACACGTGCAAATTCAGTACATACTCGTTTGAGTTTTAAACATCATCTCAAACTTACGCCAGGATCGTTTGGAGACACACTGTTCGGGTTGTCCA
AGAGGTCGGGATCCACGCCTTCAGTTTTCATTTTCGTCTTGATCTGATCGATTGGCATGTCAATACTCTTCAACTTGAAGTACTTCTTGAAAGCTGGATC
TTCCGCCACCGTCATCGGGACGTAAGCACCCTTCTCCGGCTACAATCAATATCAAACAGCACATGAGTCACCAAACCAACAGCTTTTAGAACTATTGTCT
ACGTACGCCAGGGTCATTCGGAGATATCGCGTCAGGAGTGTCAAGTAAATCGGGACTCACTCCGTCTGCCTTCATCTTGGCCTTGATCTGCTCTATGGGC
ATCTCCATGCCCTTCAACTTGAAGTATTTTGCCATAGCTGGGTCATCCTTCACTCGCAACGCCGTGTAGATACTTGTGGGCGCCACCATGCTTCCACTTT
GAGGCGCATACGCCACATTCTGCGTCTTCTTCTCCAGTTCACTGAGTTTCTGCTGCAGAGCCTTAATCTCCTTCAGACTGGCTCCGGAGGATCCTCTCTC
TCTCGTGCCTCCACTCTTCTTGTCTGCCATCAACTGGGAGATCTGTTTCTGTAGCTTGTCAATAGAGGAGCTAGTGCTAACAGCATCAGATTTGGATGCC
AGATCCAGCAGCTTCTTAATCTGAATAGAAGTCAGCCCGGGGATAGCGACACCTGACCCTCCTCGAGCTGCAGACAACGGAGCGTGGGCCACGTCTTCGC
TCTCAGAGTCGCTCTCATCCTCTTCTTCCTCGGAATCTTCTTCCTCTTCGTGCTCTGCCGCCTCCTTGTCCATCCGCGTCTTGATGCAGAAGTTGCGGTG
GGCTCGAGCGTGTCTCCTCTTGCAAGTCTACAGCCCAAAATGCTAATTAGTAGGGGCTTCCTGCTATTTCTTAGTCTTATTCTATCGACGCACCTCGCTG
CAGTAGACGGCCTGGTTACAAATAGTGCAGGGCAGAGAGGCGTTGGGCGTCGCGCAGTAGTCGCAGTCCTCGCCCGAGGCGGCCGCGAAGCCCATGCCCA
TGCTGGTGAGGCGGCTCATGAGCTCATCGTCGCTGTCGCTGTCCGCCATCGTCACTGGATGTGATTGACGCGACGCTTCTTGGGGTCTGAGTCCGAGTGC
AAAACCTGCGCCGTTTTCTCATGTTGAATTCGACAAAAATACCAGAGACGGGTCGGCCTGAACCGAGATGATGGCACAAGCAACTTTAGATATTTTGGCA
ACAAGATTTTGATGGACTGGGAAAACTCATGGAAAGCCACGGATGGCAATCAGCAAGTGGCAATTGCCAATTGCACGATTCACAAGTCTGTCTAACGAAT
GCTTCGTGCTGAAGCGATCCCCATCTTTTGCAAAATGCCACACGAAACTGTACGTGTCAATCTCTAAACTTGCCAGTTTGCAACAAGGTGTTGCTGCCAG
ATCAGGTATTGCCACTTCAACTTGCAAAAGGATCGATAAGAGTTTGGTAAAACCGTGTTCGATGTATTACACAATGAATAAATATCCCAGTGCGAGACCA
TTGTCATGGAGCTGTAGAAAACTCCGTGTCCTCGCTCTTCAATCGAGCGTGGCTGGCGGCTACTGCTTATATAGATAGAAGTTGTTGCCTTGGAAGAAAA
GAGACTGCACTTGTCCTCTAGGCTGCGGCGCGGGACAAACGGCGCTGTGAAAGCATGCGCACCATATCCGGAGACTTGCCGGTTTCGCTGATGTTGAGCA
AGTAGTCCGATCCCACGTGCTCGTTCGTGACGATGCCCGAGAAGCGTTGAAACAGCTCGCAGATGGTGGCGTGACCATTGGCTTCAGCGATCATCATCGC
ATCGCTGTCGTTCTTGGTACGCTTTTCTGGATCGGCGTCATGGCGCAGCAGGTACTCGGAGATGGCCAACGAGCCCAGTTTAGCCGCGAAATGCAGCGGG
GTGATGCCACTAGCGGTCATGACATTCACATTGGCGCCATGCTCTACGAGCATCGATACGATCTCGATGTTCTGAGACACAATGGCGGCGTGGAGAGGGT
ACGTGCCGCGCTTGCTACACGCAGAAATCTTGGCACCGGCATCAACTAATAGTTTCACGACGTCGACGCAGCCGTTACGGCACGCCGCGATCAGCGGAGT
GACACCAGCGTCATTGGCCTTGTTGACGTCGGCACCTTCGTCCAGTAGGAGTGCCACGATATCTGTGCGTCCCATGCGAGCAGCAATGTGCAGACACGAG
GAACCGTCGGCCATGGCCGTGTTGGCATCGGCGTAGTTGAACAGGATGAGCTGTACGGCGTACGCGTGGCCGATGCGGCATGCCACGTAGAGACAGATCT
CCCAGCGTCGAGCTTGAGTGAGTTCAGGCGAGTTCAGCTCGTCGATGTCGCTAGCGAACTGACTCAGCACGTGCTCGCAGAACTCCTCCATGAACGTGTG
CATTGTGTGGACACGCACGGTCTTGACCTGCAGAGATGGAAGGGCAACACGCTCAGGTTCTGCGCACTCCTCTTCATTTCGAGAAGGCGTCGAAACCTCT
TCAATTCGAGGCTCGACAGCACGTGGGGCGGTGAGGTGAACATCGCTAAGCTCGGGGGCGCTCTCCTTGAAATCACTATCAGCATCCTCTTCGTCTTGGC
CTAGCATCTGCTCAGCGCATTGTTGTCTCCAGCCACTCAAGACCAGCGGACGATGCAGCACGGCCGATGCGTCGGTCGGGAAGAGTTCGGCAGCTCCCAG
GAAGTTCGCATACGTCTTGAGCACTAAACAGCCGTCGTCCTGTAGTCTTTCACGCAATGTTGCACTGGCAAAAGTGCCGAAGAACTCGTGTAAAAGCGTA
ACGAAGGCGGCGAGCGCGTCGCGGCGTTCATTGACGGCGCCGTGGTCGAGACCTGTGAATTTCGAGCGGAGCGACCGGCGCGACGGGAACGGGAACGACT
GCAGCATCGGGAACAGCGCGTCGAATTCGCATCGGTTGTTGGCACAGCGGCACTTGTGCGCCAGCCCAAATGCCAGGTGACGGTGGTGTCGCGTAGCTTC
GGACGGATCGTTCACGCGGTCGCGGAGCGTCTTCCAGAGGCGGCGGAACTGGGAATAGGACCGCAGTGTCGTGCATACCCCATTGGGTGCTGCCGAAGCT
GGAACTTGAGCTCGGGCGTCATTCTTAGTGAGCTTGATGACGAAGAAGACTTTACCATCGGTGACCTGGTAGGAGGGCACTGCTACGTCGTACTTGTCGA
TCCAGCTCATGTGGTCGATACTCAGGCGTCGTGTTGGCGTGTGGTGGGTGGTCGGAGCTCTGTTGAGCTTGCTGGCTTCTGTCGCAGTGCAGATGGGTGA
CGGTGGCAAGTTTCTCGGCAATCAGATTGGTATCTCCCAGAGCGAGAAAGCTAGTAATAGATGATACCAGTGAACGGAAGGCAGTTATAGCCTGTGGATT
CCGCTGGTGATTGAGTTGCGTTTGGTACGAGTCCGCTGCAAGCAGCCAGGACTACGTGAATCTTTCGCCGTGTTGGCAAAAAGGAAATTGGAGCCGTCCT
CCCCTCGCTCGGCTGCTCCAAGCACATGATGTGGCGTGAGCTGGCAGACTATCGTCGTAATGTGGACCGAACATCTCGATGTCACACCCCTTGAAGTCAT
CTGATCTACCAATCGGTGGCGATCAAATGTTATTTTTGACCAATAAGCAGTAGGTCCCCCCTTCACGATTGAACGCAAAAAATACGCAGTAAAAGTCGCA
CGGCTCTGGCGAAGCGATAGCGTGGCTGGCAATTGTCCACGGGCTCGATTTGCACCAGCGAAGCGGTCTCCATTGTTACTGCGGGGCACAAACCTGGAGG
GGCGATGACCAGGGCGTCGCGGCGCCACTAGGCGGATCTGGCCATGGAATTGTATCATACCTTGGAACGACGTGTGCAATGGAGAAGGCTACTAAAAACT
GGCCGTACGTTCGGTGCAGTTGCAGCACTTGCAACCGCTCATTGACTCTTAGGCTAAGACTCTCGGTGGCGCTACCAACACGCAGACCACAGCCCTGGGA
GGAACGTACACTTTTGAAGCAAACTTTTAAGTCTTGTTACCAACTTGTCAAAGCTTTCGGGGAGGAAAAGACGATGTTGCTTGGAGGTGCGACGCACTGC
AGGGCACTGCAACCTCTTGACAGCCGATGGATTTTCGCAGCGTCCAACTCGCGAGCTTTGCTTTGCCCCAGCCGGGTGGACCTGTCAAGCGTAAGGCCAG
CTGGCTTGAACGCCATGGTCAATGAAGTTGAGGGGCTTCAGAGCCGCAGGTCCAGTGGAGCGGCGAGCAAGTCCGTCCGGTGCACTGTGTTGAGTTCCGG
AGCCGTGAATTGAGCCTGCAGTAGTTGAAGAGGGTCGAATTTCTTCTCGATGTGGTGTTGCCGGTGCTCACTCCACGGATGGTCGCAGTTGCAAACCCAC
GGGCTACACAGAGCAACAAAACAGCGGTAAACCGGATTGTCAGCGGTGGATTTTTGATGAATAACATCCCGAATTGTAGAATCGCGAGCGACTTGAAAAA
AATTGGCATAGGATACGCACCTGTCAAATCCTTGACAGCAACACTTGGGCTTTTTGCAGACAAATGGTTTACTGCCTGGGTCGTGATCGGTGTGCCTATG
TTTGCAGCGGCATCGTAGGATCCAGGCGCCTTCTGCCACGACGTAAAAGAAAGCTCTGCAGGAACACTTGCTCGACGTACACGCGAAAGCGCGGAATCCC
GCTGGAGATTTCACGCGAGGATCGTCGACGCTGCTCGGGTGCTCCTTGTATCGGTGGCCACTGTAAAAGTTAGCGTGTATTAGTTTCCAGTACGAAAGCA
GATATCAACGTGTAAAAGCCTTACCAAAGACATCTACTCTCCTCACGAACAGGGATACAGTCGCGCTTGCATTTGTCACATGACCATTGAATCACCATCT
TGGTGTAGCTCTTCATCGGAAACGGAGCTACTGCTGTGGGACCAGACAGCGCGGCAAGTTCGCTGGGCTGTGTGGACTTTCCCGTCAACTTTAAGAACTG
CTGCTTCAGTTCCGCCACCGAAACCTCGTCCTGATTGCAACTTGTCTCTGTAGTTGAAGTGAATTCAGCTGATAACTTCACATCTTGAGCTGTTTCGGGC
GGTAATAACCTTGAAGTACGCTTTACCTGCAAATCTTCAATACTCTTCTCTTGTGGTTGGGCTTTTTTCACAGCTTCCTCTTGTTGTTGATTCGGTGTCA
GATCTTCCAGAGTTGCTCCGATACGGCCGTTCAACCTCGATCGCCTTGCACGTAGTTTGCTCTTCAGTAGTTGTAAGGACTTGGCTCGCGCGGCGGAACT
CTGCTCCATTTCTGCTAAACACGAACTTGGGCGTCTCTTCAAGTTCAGGATCCATTCGCAATGCATGTAGTATACTTCGCCATTGCTACGGCAACCGGAA
TGCTCACAACCGAAGCGCTGACTTGCAACGCCGGCACGTATTTTGATGGGACCAAATGCTCGCGCTGTCCTGGAGGTACATTCGGCGTCGTACCTGGCCT
CACTTCTCCGTTGTGCTCCGGGTTGTGTACAGCCGGGTTTTTCTGCCCGGAAGGATCGTCTTCATCCCGAGAAAAGCCCTGCGGTAACTCCATCTACTAT
TGCCCAGGAGGCAGCGCTGCACGTCGCCGAGTCGATTCCGGATACTACACGATCACTTTTCCAACTCATTCGACCAATCTTCCGATGATTGACAACTCAC
AAGGTGGATTTGGACGGCAAATACGCTGCGAGAAGGGATACTACTGCGTCTTTGGCATTCGACGAGTTTGCCCTGCAGGTGTCTTCGGAGACTCGACAAG
AGTCACAACACCAGAGTGTTCGGATCCGTGTCCGAAGGGTTCCTACTGTCCCGAAGCTACCGTCGTGCCGATTCCTTGCCCACCTGGCACCTTTGGTAGC
GAACTTGGCCTAACTAATGCTCGGTGCAGTGGACTCTGTCCAATTGGAAGTTACTGGTGCGGCTTCGTAGTTGAATGATGCTGAATCGCTTTAATCTCAC
CTGCGTATTTATCTACAGTGTGCTTGGAACGATCACACCGATGCCGTGTGCTGCAGGGACGTACGGGGCGACACCAGGTCTTATTAGCTCAGCGTGCTCA
AGTACGTGTTCTGCCGTCAATGGAGTGCTTTCCTGCCTTCCTTCTCCCTGTCAAGCGGGGTATTACTGCCCGATCGGGACAAAAGTGCAACTCGAGTGTG
GAGAAGTGGGCTTGTTCTGTCCTGAAGGCTCGTCATCACCAACCACTGCGTCAACAGGTTACTACACAACGTGGAAAGTGTCCGTAACACGATTGCAGTA
CGTCGAGGGCAATCTGCAAACAACTCGATCCAATCAGCTCATTTGCGAGAAAGGAGCTTATTGCACTGGAGGGGTCAAAAGACTTTGCCCGTCTGGTACT
TACGGCGCAACTGATGGGTTATCGACTGCCGCGTGCACTGCACCATGCCCCGCTGGTTTCTATTGGTACGGATAATCTTTTGATATTGTCCACTCGCATT
TGCCTAACAGCAGCATTTTACGTGTTTATCAGTCCGAAAGGAACAGCAGACTACAGTCAGTACGCGTGCACGTTGCGGACAGAGTTCTGTCGCCGAGGCT
CTTCCGTTCCAGCGCATGTAGATATCGGATACTTTGCCGTCGTGACTTCAGGACGTCGTACTGATGAGACGATTTGTCCGCCTGGGAGCTACTGCGTCGG
CGGGGTTCAATACCTATGTCCCGAAGGTACGTACGGAGCTGCTTCCGGTCTTCCGTCAAAAACCTGCTCAGGAAAATGCCAAGATGGGTACGTGTGTCCA
CCAGGATCTTCGTCAGCCCAAGCATCACCCTGCCCAGCAGGAACGTACTCACGGAATGGCAAGTATTGCTCACCTTGTTCTCCTGGATATTGGTGCGGCG
TTGGATCACCAGACCCTGAACAGCACAAGTGTGGCGCCGCCAATACGTACTGCCCACTTGGATCCTCAGCAGCACAAAATGTTCTGGCTGGCTACTACGC
AGCAGGACAGCAGCCCGATACGCACACGACCGAGGCATTTTGCATCGTTCGGAATGCCCCTCACCTCCCTCAGTGTCCTTCTTGAACGGTAGGTGTGAAT
ATAAACTTATAACAAAAGCACTTACCATTATCGTAGATACAAGTTGCCTCTGAATCAATATAGCTTGTCATTGTACTTCGATAGTGATCTACACCAGTGC
AGATTGTCTCGAAATCGGGCTGTGTGCTGACCCGGCAGAGTGTTACATGCTTGGATTAAGGTTAATGGGAATTGGGCTGCGAGCAAACTTCTTGTTGCGT
GAGCCTTCAATGCGAGGGTGCATTGGTGGTCTAGCGGCGTCTCCTGCAAGCCCAGCACCAAAGCCTGCCACAGCGCCAAGACGCGGCGTGCTTGGCACTT
TCTAAATATCACACAAACAGCAATTAAGCCACGTTAGCGTAGAAGCCCTAGCTCATCACAGTTCCTCAGTTTAAGCAACCTACCGGGTCCTGCCGTTCAC
TCTCCTTTGTCATCAGTTGGTACTGCATTGGTGGAAGCCTCACGCCGTACTCGTTCGAGATCAGTGGCAGGGGGATACTATTGCGCTTGTCAGCTAACTC
CATAATGATCTGTAACGAAAAATATAATGTCAGTTTCCAGCTACTTCTTACAGAGCAGCAAAAATTGCCTATTCACCTCCCGAGGCGGCACTTGAGCATA
GTGGTGGTTCAGTCTCGATGAAATGGCAAGCCGAATGTCGTCTGGGTCAATTGTCTACACCAAAGAAAGAAAATGGTAGCGTTACGCCTCGTCGTTCATC
TAGACTTGAACCCCCGAATCTCCTTATCCTATACCTGTTTATCCGCGTACATGGAGTACTCTTGGGCATCCACGAGAACTTCGGTCGCGTACCCTGCACC
ACAAAAGCAATAGATAGTATAATCAATTAGTATTAAACAAATAGATACAACAATTATTGTGGCGATGCCCTTACGATGCACAAACTCTTGGAGCTGCGCC
ACGACACGCGGCTCGTATTTGTCTGCACCCATAGACTCTAGCAGCTGACGCATAGACACAGAGTCAAGTGGCTCCACGTTGGCCCCTTCTTCGCGCTCGT
TGGCATCGCCCTCGTCCTCATGGAGGCGCTTAGTGCCCTTGCTGGTCTTGGCGTCGCTGCCCATATTGCCAAATTTTGTCAAAAGAGGAAATGCCACAAT
TAAATTTGCGAAAATTATCCTGCCAGTTTTTTTTTATAAAAAGTGTGATAATTATTTCTAAAGATTGGAAAGGGTTAACTCTTTACCGGTATTTATTTAG
CTAGCGTTAAAAGCTCTTGAACGTGTGCTCTTGCGGCTTAATGCGCCATGTCGTATACTGCTGCAACTCGTGGATAAAAGCTTCAGACGGCTGCTCTTTT
GGCTTAGGCATCGCTGCAAGGTCGAATTCAGAGAGTTCTCCGATGTAGAACTGCTTGAGGTAGCGGAATGACTGGCGACTGGCATGGTAAATCTCAAACA
TGACTGTTGAATCCACGTTCATGGCTTCCTGGGCGATTAGCTCGGACCCGCCGGGGTGTTCAGGGATCCACCTCGTAATGTCCAGCACCATCCCTTGCAT
AACGAGCCACACTTCGCCCGATTGGTTTCGACGAACGACTTCCTCCCAGCGGATAGCTTCCTTCCGCACGCGCGTCTCGAACTCACCGAATCTCCGTTGA
CAAACCTCCTGCAGACCAATGCATCCGACTGTGATAGCCGCCGCTAGCAGATCGTCAGTAACTGAAGGGTCAAATTGAAACTCGGTGCCATCATTTCGCG
CTTCGTGCTCGAGATACAGCAGCACCCGATCGAATGTACAGCAATCCACGTCCACCTCGATAGTAGAAGAGGCATCTTTATGGACACCTTTGCCTGAAAG
CACAGCCGACGAAAGCTTAATGCACGGGAAAAGCAGTTTCTTCTTGACAGGAAACTCCTCCTCATCATTCGTCAGAACCGTGACGACATCGGAGCGCATT
GACGCCAAACCAGCAGAGTTAATTGGAGTGACGTTCAGCAGCTCAAACGCTAGAGACTGAGCTCCTTCCGACGACACAAACACCTGCACGTCTTCATCTA
CCCGACCGCGATACGAGTCGGGCATTGTGAACTCCGTCTCGTCTTCATCTTGGGCATCGATCTCCAGCACGCGGATGAAATAGTCTCGACCATCCTTAAA
CGGCATCACCAGCCTCTCGTGCTCTGTTAGCACCCGTTGCCACATGTATTTGGCAAACGCCGCTGCGAATTCCTTTGCATCCGTCACAATCGGAGCAGCA
GGTGGCTGTGTTGTTGCCGTTTCCACCGCTTCTTCGTCACTTTCTTCGTCTTCTACTAGCATCGGGCGGATCTCAATGACAACAGCATTGACAATGGGCA
CTCGCTCCGTAAACAGCGTCCACTTCTCCGTTTGGAACCTGCAGAGCTCCAAGTTGATCATCTGCGGGTGCGTCAACGCAATTGATCCAGGTGGAACCGC
CTCGTGTGGATGAACGGCCACTACAAACTGTGCATGCAGTCTCGGGTGCATCAGCGCTGCTCCATCAGACCCCGCCGCGTCGACGGGGAAGTCGTCCGGG
TGCAGCAGCGCACAATGACGCAGCGCTGTCAACTGCTCGGAACCGACTTCTAGCTTGTCCAGCTCCTCCACACGCAGAGACTGCATCCAGACGAGAGTGT
TGGTCCCTTGTTGCTGCTGTTTGAGACGGAGTACCGCCGCCATGGCGGGCGCGCGGATGTCACCCGCCGGATTATTGTTGGCATTCCACGGCATCTTCCA
CTGCTGCTTCTGGTGGTCAGATT