Description :
From Genome Similarity Track
Location :
Scaffold_364:6540- 7933
Transcript NameFunction/comments
Phymu_g9124hypothetical protein

Sequence
1393 bases(100 bases per row)
AGAAGGTGCCAGTGCGAGTATGGTGTGGCAGTAACGCAGCCATCAGTATTGTGAAGAATCCTGGGAACCATAAAGCGAACAAGCACATTGAGATAAGGTA
TCTCTTTACGAGAGATGTTGTAGAGCTAAGTCGTCTGAAAATTGCCTATTGTACGGCAACAGATGACAGTAGACATACTTACTAAAGCGTTGCCTACAAA
ACAGTTTCTTAAACGAAGAATGAAACTAGGAGTCCGGGATTTAGAACTAACCTCTAGAATCTAATGGGAGTGTTGAACGGTGAGCCGCGTAGCGACTCTT
CTCGCTGCCTGGCAGACAGGACAGGCCTGTCTGCCAATGATAGAATGAAAAGAAAGCACTTTTGAATTAGTTATTTGTTATGATTAGCAAGTGTTGAAAT
CGCCATCTGCGATCTGGATAGTACAAGGCAGAGAGCTGCCTGCCATCCAGTGCGATGACGACACATGTACGAGGCGAGGAGTGAGGCTGTCGAGTACACA
AGTCTGAAACGAGCTCACTTCCTCTTTGCCTCAGACCCTGAGCACGAGTCTAGAGCATAGGCATAAGTAGGAATAACATCAATAGACTATAGTGAGCTAT
CTATTAGTGGTGTCTTAAAGGTTTCATTTTGACAACTGTGCAGGCAGACACTCTCCTTAAAAGTGTGGGTGGCCGGATTATTTTGGTCTGGAGTGTAGCA
GCTTCGACATCTCTCTTTTAGTGAACAGTCTAGCTTTAATAACTTAATGCCCCGCCTAATCAGATACGATCACTGATATTAAAATAGAGGGTGACTTCAG
TCCACGTCACTCACCACTTTAGTGACCATTGACACAGTGCGCGACTAAAGTGGTGGCAGCTCATGCAGCCTCGACGCTCCGAGCGTGCGGCATCTTCCGC
GCCGACCACGCCTCCAATATGGACGCAACTTACTGGTAAATCTCCACTACCATCGCTTACCCCTGCCAGCAATGCGTCATCGTGTCCTGCTGCGCGCTCA
GGCCACGCCATGACTTTTGTGCCTCCTACATCCAGCATCCTCCTCTTTGGCGGTGCAGACGGTAAAATCTTCTTTGAGGACGTGTTTGTTCTCGAACCAA
CAGGCTACGAAGCGTCAAGTAGTAAGCCAGGACGCATGGCCACCCGTAGCAGTCGTCGTGAGGgtgaagaagccgcagaTCAAGCGACAGAAGACCTGAA
GTGGAAGAAACTCGTTGTGTCTCTTGGATCAGCATTTAACGCTCAGCCACCACGCTCACCCATGTTCTCAAGTGCTCCTAGCAACAGGGCAGGCCCCCGA
GCTATCGGATCTGGCGTGGAGAGACGTGCTCCTACGTTCTTGCATCCAGGAGGAGGCAGAGACTACCACACCATGCACTATGTGCAGAGCTCT