Description :
From Genome Similarity Track
Location :
Scaffold_1491:654- 2637
Sequence
1983 bases(100 bases per row)
CCAGTGTTGGCATATTTACATTTACATTTGACAGTTTTACGCAAGAAGGGCTTTTTACGCGCTTTATAACATTTTTACGGAGATCTTTTACATTGTTGAC
GTAAAAAGATATGGTGAAGCGCCATACTCACTTCAGCCACTCCAGCGATTCCCCAGAAGTGAAGCAGTCTGCTTAGCAAGAACCTCTCTGCCAGAAcctg
catcgtcgtcgtcgagtcTCCTTTCTGTAGCGGCTGCCGCATCCTCATGGATCTCCTGCCCGGACTGCATGATGAACACGCTGAAGGGTCCAAGCGCGGA
CGCCCTCCAAGTGCTCTCAGCACAAACTTCTACCGGCTGAATGAGAAGTGCAACAAAACGATGTGGTGAACCGTATGCAAGTATTGCTACGCGGCCCACA
CCAGGGACAGAGCGACGGTTCCGTTTCCTATCCATGTTCGCGGTCGAAAGGAAGCTTGGGAGAAGCACTTGTCTGAGTGTTTGTATTACGTTCGTGTAAC
CGGTAACACGNTGAATTTACACCGGTTGAAATATTGATATTTtggcgcctgctgcttgagtATCAAGCTGAAGCCTTGCTTCCTGACTCTTTTGTAGAAC
TGATGTCATTCAGGCGATTGCTTGTATTTTTGAACGCTCGTTGTGGAAGCCCGGGCGCCGTGCCGCACCGCCATATCATGGGCGGCCGTGTACTGAACGC
GTATGCAGACCTGCATTCGATTGAGCAGCAAGACAATGTTAGAGCGATCCAGAATCGAAGTGGTGGAAGGGTGAACTTTCTATCTGATGTCTGGGAAACT
ATCGCCAAGTTGCATGTACTGGGGTGCATGGTCGCATTGTTTGGTCGTATAATGAATTACGGTTTGAGACCTGCTGGTGATCGCCATGATGGTCTTGCAA
TTGCTCAACAAATGGAAGTGGTGATTGAGGAGCTGCTTGCGTCAGAGTGGAGGTTGGGTGCTGTTGTGACGGATAATGCCGGGCAATGcggtcgtgctcg
tcgtaTTTTGGCGCTTCGATACCCAAATATCGCGTTCGTGCATTGCTTTGCTCATGACGTCAATAACCTCGTCAAAGCCGTGCTTAAAACGGTGTTCAAA
CAGATTTCCGCGGATGCGGCAGGTGTTGCCAGTTATCTAAACACTTCTACTTCTAAATGGCTGGTACGTGCTGTTAAGGCAATGAACAAGCGCTATGGAG
ATAACTTTGCTAATTTCACTCTGTGAAACTAGATGGAATTCTATGCAGGCGTGTTTTGCGTCGCTCCTGCgtgcacgaggagctctGGAAGATATAGTCT
TCTCTTACCGGAACAGCAGCGAACTGACGGACAAGCTTCGCGTTCTTGGCGACCATGAGTTTTGGACGAAGTTGGAGACAGCTGAGAAAATTATTCGTCC
ATCATGCACCGCTTCTTTTCGTCTTCAAAGGGATGAAAACACAGTGGCTGACGTGGTTGTTTCATACATTAATATTTACCGTGGTTTTGCTTCCACTGAG
TTGAGCGACTCTCTGACTGAACTCGTGGAAGCTTGCTGGAATGCATGCGAGCAGCCTTTATTCATCTTAGTTTTTTCTCTCCATCCTGAGTACGTGGTGG
AAGCACGGAAGTTTCCTCCGACTGTGCTCACCGAACTTGACGATGTGTGCCAAATCGCACAGTATTACTATCGTCGCTTTGTTGGCGATGACGATAGCGG
TATGCGCGGTGAAATATTTGAGTGGATTCACGGAGATTATACGACATCACGCTGTGTTGACTTCAACGAAGATTCAGTGGCCAGGTTTTGGGAGTACGAA
AGAAGTCGAAGCAAAACTGTAAACTTCCATTGCTTGCGCTTACGGTCCTGTCCATTGCGGTTAACACAGCAACGTGTGAGCGCCTATTTAGCGAGCTTGC
GCTCATACTAACGCCTAAACGGAACCGCATGGGCATCGAAAGACAACGAAGCTTCAGATAATGCGTCAATATACTCAAAATAA