Description :
From Genome Similarity Track
Location :
contig_234:654- 19304
Transcript NameFunction/comments
g12220.t1hypothetical protein PHYSODRAFT_470713
g12221.t1hypothetical protein

Sequence
18650 bases(100 bases per row)
TATTTGTATAGAGATATAGGACTAGCTCAAGGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCAC
AAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTTGGATGCCTGTCAGCGAGCTTGAGGTACATTGA
ACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACCAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTT
CCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCGTATTAGGCGTGACTGCCGGTACCCTTACTTCTGAGGGACTGCGGGGGGTTCGCGC
GAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAA
CCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGAGTCATACCGTTCG
GTAGTGAGATTTTCTGCGTGTTCCTACACGACAGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCCATTTCGTAT
CGTACCCTCGGCTGTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCTCAAGGATGACCT
ACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTG
TCTTAGGGTCTGGATACGCTCGGCTGCGTTGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAG
TGGCCGAGAGTTAGGGGCGACCAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGG
CAAACCCGTATTAGGCGTGACTGCCGGTACCCTTCCTTCTGAAGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCT
AGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGA
TCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGAGTCATACCGTTCGGTAGTGAGATTTGCTGCGTGTTCCTACACGACAGAACC
AAGGATGAGATAGGCCTTAACCGTAAATCAGAACCGAATTTGCCCTGAACTACGCAAGAGCTTCACCTACGCAAAGAAACTGAAACTACATTGACCCTAC
AAGGTGTTGGCAAAACAAGGATAAGTTGATCTAGATGTTGTGTAAGTCTGGATAATATATTGATCAGATCTTACCTACACTAGTGATCTATTATCAAGTG
CAGATCTCAGATCCGACGGAGTTATTACTTGGCCCGAAGATCTCTCGGTTTCTCAACCCCCAGAGCCCCTGCTATTGGAAGCGGCAAGAAACGCAAAGGA
AGGAGATATCCACACCCCAAATGCAAGCCCCAGTGGATCAAGTCCAGGCCGCCAGGTCAGAGCTCGATTGAATCGCTCTCAATCTGGATACAGGACCGGC
AGCAGAGCGAAGACTTCCGCGTTGCTCCACCCCATCTCCGCGTCCCGCCAGGACGGTCAAGAAACGCACCGCAACATGTCTTCGGGATACTCAGAGAGCA
GCTCCAACCCGCCAACGGTACACAAGGTGAGAAGTTCAGCTGATCACGGATCATCGGAGGGCCCCCTCCGTTAGTTGGTGTCTGGGCATTGTTGGAAGCC
GAATCCAGTCTTAACCACATTTCGATGGATCCCACTACCTCACATTGGTACCATCCTGCTGAAGCGTCGACGATCCAACCTTCTGCGGGTTGACACATGC
ACTCCATCCGCGCGTAGTTTGTTCCAATTTAGGCCGTGACAGAAGGTATTCAACTGTCAGTTACTTGGAAGGAACGTAGAAACAAGGGCTAGACAGGATT
GAATTCGAACGTGGCGACTTTTTAGATTGCCGATAGGTTGAGGACCAAGCTGAAACAGCTTGTCAGCTGCTAATTGCTTCGTCCGCAGAATGAGTCGTGG
TGACGGTTCAGGAGTCAATCCAAACGCCCATTCGGTTGGACCCGTTCACATAGCACTCTGAAAGAACTTTGATCAAAGGGCCCATTTCAAACGTGCTCGC
AGAGTGTAGTCTCTCTTGATAATCCGATGAACTGTTCTATAGAGTTGTCGGTCGTAGCAAACCCAGGTTCCGAGGAACAGGACTGCCACATCAAATAGCG
TGAATCAGCAACTGCGTCTTGAAATAGGCAGCGAAAACATTAAGTTCCTATTGGGTACTCCACTGCTTCAAATAGAATGCCTTGCTTTTGCGTGAATTCT
GCAAAATTGAACAGAAGTGCATATCGTAAATCTGCGCCAGGACACAATCCGCTACTCGATTCGGAAGCGATTTCGTCCGTTTTTGAACCTTTTTTCACGG
CATGAAAGAAGCACATCAAAAATATGAAGTTGGAGTCGTACCGGAATACATACTCCAATCCGTTCAACTGCTCGTCTTCAGCGTCTCCCCTCACAAATGT
CAGCCAGAGTTGCTTCCTGGTAACATTGGTGTAAATAGAGTGGAATGAATATAACGCCATCGCATACACGCTTCCAACACACTGCGATATAATGCAGAAA
GCGACCAAGTGAATTTGTTGCGAGCGGTCTGACATGCCCAACACTAGCACGGGATAACCGTTCTGCGACGGTTTGAAGATCGCATTGGCATGAAAAATGA
AGGAACCAGGGTCCCGATCAAGACACGCCGACAATTTTCTGGTAGTAATCCCCACGGCGATGGGTTCTTCCTCCGAACCATCACCGACGATGAGCCGTCC
ATCGGTAGTTTTGTTATACATAAAAATAATCAAAGCCGATTCATCGCTATTCCATCGTAGGTTATAGCTCGAACAACCTTCAGTATGCCCTCGTGATAAT
AGTTGTATCGAAGCTGAGCCTTCGAGTAGTAGTTGGCAAAGTTCTGAACCGCACGCAACCGTGGAATCTCATTGACTTGTTAGTATTAGTGTGCCGGATC
GTAGAACAGGTTGTTTTTTTTCAATACGTTCTCGACAGAGGATATTTGCACCGCATCAGCTCAATGTAGCTAATCATATGTCTTGCTTTTGTATGCTGTG
CTGGTTTGTGAACGCACGGAACAGAGCAAATCCTCTATCTTGAGATGCGGGACGGATGTTATGCACTGTCATGGGCTTTGAACCTGTCAGCTTCACAACG
CAGTCGCTCGAGCGGGTGCGTGAAGCGAGTCCATGCATGTCCGGCGAGGTGCCCGTGATGCAGGGCCGAGCGCTATTTGCCGAGCCAGGTCCGGCGACGT
GCTCCTCAATGGACGAGCATTGAATTCACCAGGTGAGAGAATTCTTCCCCGCAGAAGCGGCCCTCTTTGAGTTGCATTTCACCCCCTCCTCCTACCGGTT
CTTGACATGCTGTGCAAATACTATATGTCAAATTGACACTGTCAGGGAGCGGAGGCGCTTGACGATTCATCGACGACGAACGCTGTTCATTCAAGACTTG
AAGCCGACCAGATCCACCAGGCAGAACGGTTCTGCCAGAACCGAACAATCCGTACATGTGATCAGCGAACATTTGCAATCCAAATGCCGAAATGGATAGG
TCCTTTTGCACCCGCCATCTGCGGCAGCAGAGGCTAGAGTCTGCCAGACTCAAGGTGGCTGCCGTACATGTAGACCACCTTGATTGATTGAATAGCAATC
GCGACGATCACCATCCTAAGCACTGATATTTGAGAGAATAGTAAGCAGCGTTGCAAGCACTGAGATCAGTGTTTAAAATATAATTAATATTATATTTCTG
AAGCTTGACAGGATTCTTCAGCATTGCTTAGCTCAGTCCAGCTACTGGGGCTAAGAAGGTTGTCACGTACAAGACGTGAACAACAGCTTGTGTTCACTTT
TGAAGTTGCAGTACTTGTATAAATAAATGCAAACCCGCGCGGCACAGAAGATGCCATGCAATCGTAAGTGCATGTACCAAAATCATCCGCCTCCAGCGCA
AGAGCAATTAGAGCCCTAAGACCGTCACTTCAACTAAAAGCGAAGAGGGAAAGAGAAGCCGCTCCTTAACGAGGTACAGTACCCGACAGGGTCGTCAGGT
GGAGGTAGAAGAGGAGAAGGACTGAGAGGACGAACCATGGAAGTTAGCTCGTGTCGCGAACCCGGGGTATTCCTTTGAAGGAAAGTTTATTAATGATGAA
AAATGAAGCAAAGTGGAAACTGGGTAGGGCTAACTACTGTCCTCGACTCAGGTCTCGATACTGCTCTCGGCTCCCACCCCTCACATGGCGGACGTGTGCC
TTCGCCCACTGCTTTCTCGCGCTGCGTGCAGCGAGGCACGTCGCGTCTTGAGTCAATCGTCTTCTTAGCCGCAATTGGCAGCGCACACCGCGCTGTCGAA
ACCAGTCCCCACCATAGGCCACAGTAGAAGACACGTCATAGCTCGACGCAACCACAGCTTGACACGTCAATCGGCGACACTGCCTCCAAAGCTTGGTCGT
GTTGGGCTAGTTGAGTTGTTGTAGGAAGTCCGCATCACCACAAGTAGCGGCGTACTCACGGACCTTCGCAGGGACATCTTGGAGCAGAGTATCCAAGGGT
TCCCATGAATTTTCGATGGCTTGAAGTACAACCCACGCAACAAGCAGTTCCCAACGATCGAACTCCTCATTGAAACGGTGCTCCAGGAATCCGCTCACGC
CCACCACCATACCCTGACTGGATGCCAGCTCCAGGAGCTCATCAGTGGTGTTTAGCGTTGAGTCCGCGTAGAATTTCAATCGTGACGCGTGCACCTCGTA
GACACGTCCCGTGACCAGGTGCTCAATCTTGAAAGAGTGAGGCAACGCCTCGGTAACCTTGAAAGAGCCTACCCACTGACCCAGCAACTTGTTGTTGGAC
AAACGCTGGTCGATTCTCGACCACAGCACAAAATCCCCGACATCGAAGTTCACTGGCGTGCCTTTGTGCGTCATCATGTCTTGAAGACTCTTGCGTTCCT
TGGCGTCAGTGACGTCACGGTGCATTTGGTGTAGTGACGCGCGCACATTCTCGAGTTGATCGCCCAAATCTCCAATTTCAATGACGCGCTCTTCAGTGGT
TTCGCTCGCTGGTGCAACCACCACGTCCAGTGCCGATGAAGCAGGGAGACCAGTAAAACCTTCAACTGGAGAGTGTCCCGCTAGTGACTGCACCGCAGTA
TGGTCCAGATTCGCCTGCAGAGCTGGCAGCAAGTACGGACATTCGTGATAGTCCAAAGCATACTCCAACAGCAGTGCCCGCAGAACTTGAAGGACATCTC
TGTTGAGTCGTTCAACGGCCCCATTGAGCCAGGGAGAGTAGACAGGTGTGAAATTCTGCTCAACCTTGAGCCGAGCTGCCATGTGTCGCATCATCTCGTT
ACGGAAATGAGCTCCTTGGTCCGAAAGCAACGTCTTCGGAATTCCGTACCGAGCCGCCCACATTAACAACGCTTCTGCTGCCACGTAGGCTGTCGGCGTT
GCACACGGAAACAATTCACAAAAATGTGAAAGACCGTTCTTAACCACAAGGAGGTATGCTGATCTCCATAACCTTCGCCATGACTTAAGAAGTCCCAATG
CACCACTTCATTGCGTTCCGTCGGAGTCAGCAACGGGCCATACGGGCGAGGAATCAGCCGCGAACCCTTCACATGCTTGTAGAGTAGGCACTGGCGGACA
AACTTGGCCACTTTGTCCTCCACTTTGGTGATGTAAAACCGCGCTTTCAGAGCCAACACCATTGCTTCCTGACCGCGATGACCCTGTGGCCCACAGTGTG
CGATCACAAAAATTCGCGCGAGTAGATCCTTCGCTCCGGTTGGGATCCATGGAAGTCCACCGGCGACCAGCACGCCACTCCTCGGAAAGAGTAGCTTGTA
GTCGAGATTTCTCACGGGCAGTGTCTGCTTGGGCACTCGCAATGTTATCCCAGGTAGGAAACACAAAATCCGCGTCCATGAGCGGGCGAAGCGCTGACAA
CTCGACCACGGGAACGACATGACGCCCTCGCGTTTGCACAGCAGCCACTGAAATGGATTCCGCTTCTCGTACGTGCCACCTCGACACGATGTCTGCCCAT
ACATTGTCGTCGCCCGATATGTGTTCGATCCGATAGTGGAGCCCACACAAGCGCATTGCCCATCGTTGCAGCCTGTCCCGAACGTGCTTCTTCAACTCGT
CATGAGGGGCGAATATGTAGATAAGGTTTGCTGGTCGCAAAAAGTCGAAATCCTTTTGGACGAAGAAGTAAGTACTCCAGATCGTTGCATGCCTTAACGA
TCGGATAGGCTTCCTTCTCGATGACAGTCCAGTTGAGCTGCGAACCCTTGAACATGCCACCTTTGCAAATAACCAATTGGTGATCCTGTTGCTTGACTGC
GACGCCAAATTGCCATTGGCGGACCTGGGTCACCACGATACTGAAACCGGAGAGTGATGCATCAGTGAACACGCACAAATCTGCGTCCTGGTCTGGGTGG
ACCATCAGTGCAGAATCTCGCACCAGCGATACCACGTCTTTGAAGGCATCTCGTTCCTCGTTACTCCACTGAGTGGTAACCTGCAGTGCGTTGCGGTTCC
GCTTGCCAATCTTCTTCTTCTCGGCTTCCAACTTGGCATGGAGCGGTGCAATTACGCGGGCATAGTCTGGCAGTGAGTCATGTAGCCAGTTTGTGTGAAC
ACAAAGCGCTGCAAGTCGGCGACTGTAGCGGGAAGGGGGAGCGTTGATAGCGCATCCATCCTCATCGGGTCATGTCGGACACCATCCGCCGAGAAATACC
GCCCGCACAAGAGGATCTCCAGCTCGAAAAGGGAACTCTTCTTCATGTTCACCTTCAAGTTCGCCTCTGCAACAATTGTAAAAAAACTTGCGCAGCACTA
CCAGGAACTCAGCAACGGTCGGTGCAAACAAAATCACATCATCCACCCACACCAATGCCGAATGCGGGATGAGCGGAGCCAGGAGTGTCTGCATTTGAGA
TTGGAAATGTAGCGCCGAGTCCATGGCGCCTTGAGGCACGCGATTGGGCGTGTAAACTCCATCCGGCGTCACAAATGAGAACAATTCCTGGCAATCAGGA
TGTAAGGTGAGCTGCCAAAAGCCGTGAGTCAAATCGAATCTGGCGAACCTTCTTGCCAAGCAGTACTTCCATAACCGTAGCAGTTGACGGCATCACCCCC
GCAATCGGGGTGGTCAACCGGTTGACAGGGCGATAGTCGATGGTGAGGCGGAACTTATCGCGGGACCCAGGCTTCCGAACAGGGACAACTGCACAAGCCC
GCGCGCCGCGTTGTTCTTGGTCACCAAACCTTCCGCCACCAGAGACTTGACATACTCGCGAAAACTCAGCCAGTAGTGGTGCATACTTGCGGGAGGACTT
CGATACGGCCTCGCATCTTCACGTAGCCTGACATACAGTGGCTCAACAGACGCCGCCGCACCAGAACTTACAGCATCGCGCCAAATTTCGGGAAACAGCT
CCAGCATCTCACGCACTGCTGTAGTGTGCTCATGGGTAGACCGTTAGCAACCGCTCGATCCAGCAATTCATCCAATGTTGTAATGGGGGTCGATGCATCC
CAGGCAGCTCGTCACCCACTGGAAATTCCTCCTCCTCGTCTTCCAACAACGTCGAATCTGCCAATTGGGCCAGAGTCTGGTCAACATCGATGCCCAAACG
TTTCAAAGCGTCCTTGCCAAGCAAAAACTCGTCGCCTTCACCCTCCAATACAAGGCATGGCACGGCGCGTAGGTTGACAGCGTCTGCGATGGCCACGAGC
TCGAGGTCCAATACTACCTCCATTTCGCAAACTTGCACGCTCCCATCAGCTAGTGTCACACTGACGGGGGAATCAAGGGCACTATCCCAAGACCAGGTTG
CACGGCACGCAGCGAGTCTGCCATCGCACTGGGGATCACGCTCTGGTCAGCGCCAGTGTCCGCAATGTACGCGACCTCAAGAAGCCCGTTCACTCGCACC
ATGTTTCTCGTTGCTCCAGCGCGTACCGCCTTTGAGCGAACAGAGCCTGCACGCTGCTCCTTAGCGGCCTGATACTGCTGACGCGCGGCTTCCTTCTGTG
TTTCGTCGCTGTGGGCAGTCCATGGGCCAATGGGCGTCTCTACACACCAGGCAGCCGTCTTGTGGTGGCGGCCGAGGGGTCGGGGTGTAGCCACAGCGCC
ACGAGGTGCTGTCGGCGCAGGAGCTGAAACACGGGAAGCTCCGTCTGTGGCGTTGGGTTTTGATGCCGAACTGTCACGGTCCGGCTGACGTTGCACCTTT
CAGTGAACGGCGACAGAGCGTCTTGATTGGCGGGTCTCATTTCCCGCGCTATAGTGACCTAGGAACAATAGTGACCGAGGTCTCGGCTGGGTCTAATAAA
ACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCCATTTCGTGTCGTACCCTCGGCTGTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACAC
TTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAG
CCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTGGGATGCCTGTCAGCGAGCTTGAGGTAC
ATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACAAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGA
GTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTGACTGCCGGTACCCTTACTTCTGAGGGACTGCGGGGGTT
CGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACA
ACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACC
GTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCCGGGATTGGTGTGACCTTCTGTGTGTCTTGGTTGCATATAGGTTCTT
ACCTTAACGAGCATTCGAGAGAAGAAAGAAGAGAAGAAGAAAGAAGATGGCGAAAGAAGCGAAGTCAGCGGTACCAGCAACGGCGAGGTCAAGTGGAACG
CGTACCGAGGGTTCGGGGCGTTCCGGTTCGTCGTTCGCGACGCCGAGTACGTTGGCGTCGATCAACGAGCGTTCGGACAGTTTTGATGAGCCGATGGACT
ATTCTGACGCCAAGGAAGATGACGAAGAAGATGACCTGGAAGAGAAGGCAGCTATGCCCGAGCTTTCGGAAGCCGCTGCAGTATCTGCAGGACGCAGCGG
AGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGCTGGTCCCGAACCAGCCAACGGTTACGACGAAGATGAGTCCGACGATCAC
CGATCGTCGGCGATGGCCGAGGATGCGAATTCTCGGCCGAATGGCGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAACCGAGTTCTGGGTCGAT
ACCTAGAACTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCGGTGGCGAGTTAACTGT
GCCCGTGGAGTCGTGGAATACTCGGCAGGTGGCCGAGGACACGGTGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGTGTTCCCGTCGGAAGCAGAC
CTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGTTAGCCGTC
CACCGAACGTCCGCCACGCATCGGATCCGGTCGACCCGTCCATGATTCCGTTGCCAGTGACCCCTGGGAGACGCCCCAGAGGGTCGACCGAGGCCGGAAT
ATTTTCGGCCCAAGGTGCGACGTCGTATTTCCAAGACTCTCACATGGTGACGCCGAGGTCGGTCAGTCGTACAGAACGACTGGCGAGAGAGGCCGAGGGA
TATCGAACCGCTCCGACTGCTGGACGAAGCGCAAGTCGGACGCCCAGCCGACGTTACGACCTCCGCGATGACTCATCTGACGAAGATTCGTTCGACGTCG
GAGACACCGGGGGTGACTTGACGGGAGAATGGGCACGCCAAATTCGTGAGCTGAGCGCTGTGGGAATGACAGTGCGACACCGAGGCTAGAGATCGCTACG
CATCTCCCACTCGGAAACATCAAGCCGTACTTGGGACTCCGCGATAAGAGCGAGAAGTCCATGCAGTGGCTCCGAGCGTTCATATACGAGATGAAAGGGA
CGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTGCATTGGTACCGACAGCTGCCCCGCAAAACGAGACGCAC
GTGGAAATTGTTGAGCGATGCGTTCATTAAGTACTACTGTTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGGCCAAGCGAGAGGAGAAGGAG
CATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGATGCAAAGGACCACGTCGAGCACT
TCTTGGATTCGTGCGAAGACCGAGGTCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAGGATATGATCAATGATATCCTTCG
TCGCAGAGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGGTAGCACGCCGACGCGATGGTGGACGCTCCGAGGATCCGCGG
GACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACCGAGACGATAACCGTCGCCGGGATGACCCAATATCGACCG
AGGGTCACTCTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCTCGGTGGACGCGCGTGGAGGATACCCGGAAGCGTACAACGACG
GATATGATGACACCGAGGAGTATGGGCCGGAGTCTCACTCTGGCGATGACGACCGATACTCCGAAGGGTACTCGGACGACGGATACGCGTCGACCGAGGA
CCGAGGCCACGTGGCTGCTGCAAACGACTCTGAACGTCGCAATGCGGCTGAAGGAACGTTCGCTCGCGCCGACAACCGTCGGCCGAGGGCAAGTAACGGC
CAACGCCCGTATGACCGAGACGACCAGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGGTCCATGCGCCGCCTGCGGAGGACTCACCCATT
CGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAAACAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAAGAACTCACGAATCTCCTCCGAGCTAA
GGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAATCG
GGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGCATTCGCAGGTGTGAGCAAACGGCCTGATGACTTGAATATGGAATATGTGAA
AACGACGGAAAATGTAAAGGAGAGAGGCGTAAGCCTCGGTGAGAGTGAAGTGAATGGACGACGTGTGGACGGAGACGGAGTGGAGCTAACCGATGCTTCG
ATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGGGGTGGTGGTCATCCCAGCGCT
ATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGACTCGCGAACGAGGATTCTGCTGGACACTGGAGCGAATGTCAGTGTGATTTC
CGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCGAGGAATTAACCCAGGGGTGATGGAGACCCGCAGA
CGAGCACTCGTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGGTTATGGATCACAGTGCAGGAGTGGACGTGGTCCTGGGAACAG
ACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACTGCGAGACTACCGGACGAGGTAATGGTGCCCCTGGTGAAGTCGCAGAACCCAGC
AGAGGCCGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTCGGTCCCAGGGCGTGAGTGGCGAGAATTTAGGTTACCACGACGACGG
CCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGAGGGCAGCCGACGATGGTGCGACTAA
CGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTACTGCTGTGGGTGAAAAAGGGTGACCTGCCGCAAGGGATGGATACACTCGTTTG
AACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCAAACTCTACGAACGATGGTTGG
CAGATCAGCCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGACGACTTGGAACCTAGACGAGGGCCAGATAA
CGTTCGCGAATAGGGCACTGAGGAACCGACAGAACGAGACCGAATGCCGTTGACGACTTCGACCCTCTGACGAACCCGTTGGAGATAGATGGGTCGACGA
AGATGACGACTCGGTGGCGACCGACACCTCTGATGGCGCGGATACCACGTATACGAGTGAAGAGAACTCCATCCCAGTCCTCGGTGATGACCCGGAGACC
CGATTGGACTCTGCCTTCGTAGCAATGATGCATGAGATTACCCGGGGGACGGTTCAGGTAGTGGAACACCGATACCAATACGTCCGAACATTTAGCGAAT
GAGATCGAGTTGACGGACTATGCACACGAGTTGGCGTTCTTACCGGACCTGACCGAAGCCTCGGAAACGGTACTGGATTATTCAGGACCGAATGTTCTGA
ACCCGAGCGCGACAGCCCGTCAACAAGAAAGTCTCGTTGCGGTGCTGAAACGACACGAGAAGATCATGATTGCGAGTGGGAATGCTCTGCCACCACCGGC
CTACGGTGTGGTGTGCGATATTGACGTACAGGGGCATCCACCCATCAAACAGAGAGCTCGGAGAACACCGCTCCGACACCTTCGGAAGCTGTACGAGCTT
CTGAAAGGCTTGCTGAAAGCTCGTCTAGTGGCGTTTTCGGACAGCCCATGGGCGTCGCCCATCGTGATCGTGCTCAAGAAGAATGGAGTTGATATTCGGT
TGTGCATCGACTACAAGCTGGTGAATGCAGTGACGGCGATTATGGAGTACGCCATGCCGTTAGTCGACGACTTGTTGACCGACCTGGAAGCCTACCTATG
GTTCTGCTCTTGATGCGGCCAGTGGATTCTGGGCTATTATGATGACGATGCGGGCCCGCAAAGTCTCGGCATTCGTCTGTGCACTCGGACATTTCGAATG
GCTTCGTATGCCGTTTGGATTGAAGAATGCACCGATGATTTACCAACGAATGATTGACAATGCTCTGTGGGGTTTCGTCCAACCCAAAGCTGGCTCCACT
TTTCGGAGCTTATGCGAACGGCCGAAGCCCACGCCGAGGTTGCGCGGACAGGGGTGACCGACCCTTCATCGCGACGACTCGAGGAGTCAACAACTCGGTG
ACCAAATTCGAGGCCGACCGCGAATCCTCGGTCACGCTTGACGCAGTGAATGGGTTAGTGAACAGCCCTGTTGCCGACATGTTCTCCACCGGAGAACCGG
ATGAATCCTCGTTGGTGCCAGTGTTCGACCGACGGTCGTTTGTCGATGATATCTGTTTTGGGTCCGAGACTTTCGACGCGTGCCTGGAGACGTTAGACCG
TCTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCAAAGGTGGATTTCCTGTCACACGAAGTCTCTGCA
GAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATT
ATTACAGTCGATTCATCCAGGACTTCGCAGTGTATGGAGCAGCTTTGTACCAGTTGAAGGACGAAGACTTCACGCCTAGTGGCAGCCTCTCGGCAGCCAA
ACGAAGCTTCGCGCGCTCCAACAGAAGGTTGCAGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGTGCATGTCACGTTATTCGCGAATGAGT
GGGCATTGAGCTCCACTTTGATGCAATACCATGATGACAAGCTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCC
GGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGTGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTC
GAATGGGTGCACAAATCAAGACACTGTTCGGTCGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGA
TTGTACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCAGTTACACCGCCGACGAAAGGGTCACCTACT
GCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTG
GATATGGCAGTTGCTCGTGGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGA
GTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTA
GGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTTCAACTGAATCGTCACCGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCACGTGGTCC
GAGAATTCAACGCTGCAGCAGATTCGTTGGCAAGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCGA
GCTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGCCCGTGGA
ATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAACTGCAACAACCAGACACCAAGCAAAAGCGAGGAAGAAACGAGTCC
AGTTTGCAGATGAAACGTCGGTGATAGAGCCGAATGGAGCGGCGAGCGAGACGAAGCGAATGGTGTGACCACCGAAGCTCAGAGTGAGCTGAGAGCCGAG
CAATCGAGCAACGAGGTAGACCCTGGCGCTCCAAACGCAGAAGACGTTGACCCTGTGGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGG
ATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAACAGACCTCAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAA
GTTCGTGCTTAGCGAGGATGGTGTACTGTATTTTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCC
ACAACGATGATTCAGGAAGTACTACGGAGTTGCCACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATT
TTTGGATTGGACTATATGCAGACGCCGAACGACACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGG
AAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGGCAACTCAGCCCTACTACTGTTCCAG
TGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTCAGACACTACCGCTCTGAGGGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAG
CACCAACTCTGATCCGACATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAG
CTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGCTGCAGCAAGACTGGGAC
GAGATCGCGGAGCGATTGATCTTCGCTATCAACAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCACAATCCA
CGCTGCGAGCGATGTCGTCGTCACTCAAACGAGGATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAATCTCGTG
GAAAATGGCAATGGAGTACCAAAGTGTCGAGAAAGCTCGGAGGGCGAGAGAACACAATGAGTCGCTGGAGCGACGTGAGAGAGCTGCAGTACCGAATGTC
GATGAAAACGAGACTTCTGACGAGTCACAGGTGGAGACGGGGGCAACATCTGATCCCACTGTCGAAGGACCGAGGTCTCTGTTCCAACCCGGAAGCAGAG
TTTGGTTGTATATGGAACGAGTCAAGCCAGGGTTGACCAAGAAACTCGCCCACCGATGGCATGGACCATTCAGGATCAAGAAAAAGATCGAAGAGTTTGC
GTACGAGTTGGAATTGCCAGACCGAAGTGGGTATAGGTTCTACCCGGTGGTGCACGTGTCCCGACTCAAGGCCGTCAACGAATTTGGAGACCGACCGAAG
AGTCGGTTAGCACCTGAAGTGACCGAGGATACGAGACTGGACTTCGACGAGGAGTTGTTGCCTGAAGATAGCTGGGAGCCAGACCAGCTCGCTGGCGAAT
ATGAGGTAGAAGCCATCCTCGATGACCGATCCCCGCTGTCGACGGGCACTAGCCGCGCTGTCCGAGAGTTCAAGTGAAGTGGATTGGGTATGATGAGCCC
ACGTGGGAGCCTGCCTCAAATTTATCATGTGGCGGGCTACTTTATGATTATCTGCGGACTCGGCGCAGCGAACGACGATTGCAGATGGTTCAAGTCGCTG
ACGAGAACTAATCTGGAGAGCTACCGAGAGTTGAACTGTCTACGGGGGTGATACAGCCCGTAGCAACAGATGAAATTTGCTACTGTATCAAAATTGCGAG
TGACCGACTATTGATTGCTACCAAGCCTCTGACGAGGCCTGGTTGCGACGTCGGTTGACGAATGAACTGCCTGCGGGGATGATGCAGCCCGCAGTGACAG
ACGAAAACTGCTACTGCATCGAATTTGCATATTTACATGTGACGTGAACGATTTTCGAATGGAATTGGATTAAATGGAATTACTTGGAGCTCAAGAACTG
CCGCTACGGGACTACGGGCTTCGGACGGCACACTGGCAGCTTGAGGAACGAACGGGAAAATTAGTGAGACCAGACCGAAGCCTAGACCTCAGTGGTCGAC
GCGATGTTAGCCAAAACATCCAGATCCGACCCTTGAGCAGTTGCCGGCTCGTCGGCCGGTGCTGGGACCGAGGAGTGACTTGGAGAAGACTCGGAGTCAC
TCATTCCATCCTCCCGCCGGCTGACCAGTGACACCACTGACAGAAGCTTGGACACCCATGGAGCCGTCACCAGCCGACGACAAGATGGATCACCATCAAC
CCGGACACCACCTCCGCTTGCGTCATCCCGCGGCACGACAACAGGCACTGGGGTTACACGGAGCGAACGTGGTGTTGAACGGGTGGCTAGCCGGCGGTCG
ACCCAACAATTGCGCCACGGCTGCCTGTCGTCCAACGTGGCGAGCTCTCC