Description :
From Genome Similarity Track
Location :
Scaffold_2258:654- 2435
Transcript NameFunction/comments
Phyag_g12265ABC transporter-like protein

Sequence
1781 bases(100 bases per row)
CCATGCACCCTCAGCTGGAAAAACCTGTCGTACACTGTTGAAACTAAGAAATCAGCTCGTTGCcccgacggcaagaagacTATCCTCAAGAACGTCTCCG
GTCGGTGTGCACCAGGTGAACTCACTGCCGTCATGGGGCCCTCCGGATGCGGCAAGACCACACTCCTCGATATCTTAGCAGACCGAATCAGTTCCGGCAT
CATCCAGGGCGAAATCGCACTCAACGGTGAAACCCGAAATGTCAGGACGTTCCGAGCCGTGTCGAGCTATGTGGCTCAAGAAGACTCTCTTTTGGGGTCT
TTCACGGTGCTGGAGACTTTGGAGATGGCAGCAAGACTGAGTCTCCCCAACGCGGTGACCCACCAAGCTGTAGTGGAACGGGTGCAGTCAGTGATCGACG
ATATGGGGCTGCGTGTGTGCGAACATACTTTGGTCGGGGACATATTCCGGAAGGGAATCTCTGGTGGCCAGAAGCGCAGATTGAGTATCGCCATTGAGCT
GCTATCAGATCCATCCATCCTGTTGTTAGACGAACCGACTTCGGGTTTGGACTCGGCATCTACGCACAACGTCATGCAGTTCGTCTTGAAATTGTGCAAA
GAGAGTAAGACGGTCATCTGCACTATTCATcagccgtcgtcgctggtgtACGAGATGTTCTCCAACGTCGTCATTTTGACGGCAGGTGAGACCGTGTACT
TTGGTCCTCGAGAATACATCGTCGACCATTTTTCAGCTGCAGGACACACGTGTCCGATGTACATGAACCCAGCCGAATATTTTATCAGCCTCGTGAACTC
GGATTTCGAAGGCCACGCAGACATTGAAAAGCTTGTCGACAGTTTTTCCCacagctccatcgccaacaagaTCGTGGCGAGTATTGAAGCTGATGCATCG
GAGGTTCACAACGTCGCTCCAGTTATCCCCGTCAAACCTTCGCCCATGCGCCAATTCGTCGTGTTGATGCAGCGCAACTCAATTAACAACGTTCGAAACC
CAGGGATCTACTGGGTCCGGTTGGCCATGTACACGATGCTGTCCTTCATGGTCGGCACGATGTATCTCTCCACCAACGACGCCATATCTGAGGAGGACAT
GGTCCCGTTACTCTTCTACGTACAAGCCTTCCTGGTGTTCATGTCGGTGGCTGTACTACCATTCTTCATCGAGCAGCGAGCTGTTTTCTTACGAGAGCGA
GCCAACAGCGGTCTCAACGTGTTCAGCTTCGCGCTGGCCAATTTCCTCGCGACACTCCCCGGCATTTTCCTCATTGCTCTCGTGTCGACTCTACTAGTGG
TTCTGCTTTCGGGGCTCCACGGTTTTGGGTACTTCCTGCTCAACTTGTTCCTATccttggtggtggcggagtCGTTGATGCACGTCATTGGCGCTGCCGT
CCCCCACTACATCATTGGGATTGCGTTGGGCGCTGGCATTTACGGCATGTTCATGCTGTGCGAGGGCTTCATGGTCCCCAAGGAAACGATCCCGGGCTAC
TGGATCTGGGCCTACTACATCGCCTTCCACACGTACTCGTTCAAGTCGTTCGTGTACGAGCATTTCATCCACGTGAATACACCGGCAGCCAGGGCGATTC
TGGCGCGATTGGATCTGGAGAACGTCGACACGCCGCAGAACATGATCATCTTAGCGTGTTACGCTATCGGACTCGAGCTCATTTTCACCTTCATCCTGTA
CAAGTTCCACACCGGGCGTCGTTAATCTAGAGATCGAGACAGTTTACTTGCTAGCACAATTACACATCTAACACTATTAGG