Description :
From Genome Similarity Track
Location :
Scaffold_120:65394- 71144
Sequence
5750 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGGCTGAGTGTGTGACGTCTCCTGCCAAT
GCATTCACTTCTTCCGATAGATGCTTGAGTACTTTCTCCCAGCGTACTGTTGCTGAAGTGTCCTCTGACAGCAACACTTGTGTGCTTCTTGTAGAATCCA
TTGCCATATTGGCCAGTGTGTCGGCCATCCTGTTAAACTCCGGCAGATGGTGGTGCCATGCCACCGCTTCAAGTCTATCTGCGAGTCGCGAATGAACGGT
TGTCAGCGCGAATCACAACATACCTAGCTGACAACCTGGCACGTGTCTACTTCTCGGTTTAATGAGCAGCACATTGATGCTAATTATGAATCTTGTACTG
TAGAACAGCAAGCTCAAGTGCCCGACATCGTCTTCCGCTGTTGTCGCTCGCCATGTGTTGAGAACAACACATTCACGCTCGAAGCGGCTGCGCAAATCAT
ATAAGAGATCTTTTAAGCGAAATGAATGTGGTGGTCGACTTGATGGCAATGTACTCTAGACTGGTCTGTCAGTTGCAAACGATGATTCGCACCGAGCGCT
TCACCTCGACGTCGTAAAATAACCCAGCCCCTCTTGTAGTCCTCGCATGAAATTGAGCTCTGAAAGTCGTAATTAAACACACTGTGTTAGTATTTTACTT
TCCAAAGGGAGTCCCTAATTCAAACAAACGCAGCCGCAACGTCCCACTAGCAGTAATACCGGCTATTTAGATACGTAAAGGTTCGCGAGCGCGGGTCGCG
CTGCCTAGAATCCGTATACATTGGACGTGCTGGACAGCGCAAGACCCACCCAAACAGTTCGGTCAATCGTAAGCTCAACACATCGTGATTGATGTTACCT
CTTATGATTATCGGGGAAGTAAAAATGCATATCTGCAGTAGAAAAAGTATGATCAAACCTTCAATTCGATACCAGAAACAGTGAGCCACACCTCCAGAAT
ATCTACCTGTTGAACCCAGCACCAGAAAAACCAATCTTCTTGCTATTAGACCAGGATTCGTGACCATATAGTACTCCCATAGCCAAATAACAGTAGTGCG
ATAAAACGTAAATCATAAAAGGCCCGGCTGCCAAGGAAACTCTAAGTTTTTTCAACTAGGTAATTGAGTTATTCAATCGTCGTCGCGTTCTAGCAGGATC
TTGTTCGACGCCTACTCTGCGTATAACATCGAGATCGCTAGCCACACTCGGCGTACTAGCATAAAGTTGATTGAATAACGAACCCTGTTGAAACAGGCTA
CACGCTAGCCACGAAGTAGCATTTGTGCAGCCTATCGCACCTTTGACTGATTTCTGCAAAGGTAGCATATCGCGCTATGCGTTGACATCTCGCTGCTAGG
GGGTGGGAGCGGGTTGCTGCCTTCTAGGCAATGCTGCCGTTTCCGGAGGCCGCTCGCTTAACTGACCAGTGGCCGTTTTGACGTGCCTCTTTTGGCCGCT
CTGACACGTTGGCGCCTGCGCGAGGGCATCCAGTTTGTTGCCGCGGGCGTAGAGCCTACTGCGAGCCCTTGCCGCAGCTCGTATGTGTTCGCTTTATTGT
AACGTGATTGGTCAATTTAGGAAACCGGTTTAAAGTCGTGTAAGACCAGTTTCATACCGTACCAGCTGTGCTCATGACCTGTGAATACGTTTTGAAGAAC
GACACACATTGCTGATCATTCCGCTGAAGCGTGAGACCTCCCCCGGGCACAGCGCTTGCCGATGTTCGGGTCGGCTGGGAGCGTACTGTACAGTGCGCAG
GATTTGGTAGAAGGATACTACCAGACCCTGGTGCGAGAGAGCGACATCCCGCTCACCGTGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGACCCGTCG
TGCCGAAGGGCCTGTCTCATGCCCCAGCGACGTTTAATTGCCTGGTGACGCAACTGTTCCTGCGACTACGTGCCTTCGTACAGACGTACTTCGTCGTCCA
TAGCCGTGCCGAGGGGGGGGGGGGGGGAGACGACCATGGAGGTGCATCTGGCTCACCTCCGTCAAGTGTTTTATGTTATGCGAGGAGCGAACAAGCTCTA
CGCCAACATCGACAGGTGCACTTTCGCGTCACCAGAGATTTAAAGTTCCTCGGTTGCTTCGTAAGAAACGTGGGCGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCCTGCAGGCC
GACACGGCTGGACGTGAACGTGTCATCTCGTTCCAGTCCAGACAGCTCAAAGCCGCTGAACGGAACTACCCTGTCCACGGCAAGGAGCTCCTGGCAATGA
AGTATGCCCTTGTGAAGTTTTGGTTTCACCTACTGGGCCCCCGGCCCTTCGTGATCTACACAGATCACGCATCCTTGAGGACGGCGACAAATTCGCCTCA
CCTCTCTCAACGAATGACGAGGTGGCTGTCCTTCTTCGCGGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTC
TCTCGGCGTCCAGACTACGAGTTGGACCACATCACACGGATGACAACGCATCTATATGATCGGATACTCATGGCGTAACGAAACGATGAGGCTGTCGCGC
CAATCGCAAGTTGCTTCACGGCAGGGAGCGAGCGCGAAAGACCCACTGGCTTTCGTCGCGACAACGGACCCGAATCCACCGATATGGTCGGCCGGTAAGA
CCTCCTCAAGTACTGGGTGGAGCCCAGTGAAACCTCCACGGCTGGTTCGTAACCCACGACGAGGGTGTGCAAGCTCCATAACTATGCGAAACACGGACGA
CGCTACGTCCCGCGGGCCCTTTGAGGAGACGACATTTACAGACTGCTTTGACCGATACGCTGAGGAACAGTGTGGAACATGTCAGCGCGTCAAACCCGCA
GGGCACTCTTCGGCTCCACTACAGAGTCTGCCCGTATCGGCTGCCTATTGGAAGTCGATGACTCTTGACTTCATCTTTGGACTTCCCGCCGACGGACACG
GCAACACCGGAATTTAGGTGTTCGTGTGACGGCTGAGCAAGATGGTACATCTTGCTCCAGTACCCGTCACTGTCACATGCGAGCAGACGCGAGGCTTTTC
GTCGATGGCGTGTTCTGCTATCACGGTCTCCCGGAGATGACTGCCTCGAACCGAGACCCGCGGTTCACCGCTGCCTTCTGGAAAATGCTATTTTCTTTTC
TCGGAACTCGTCTGCAGATACCCCCTGCGGACCATCCGCAGACAGACGGCCAGGTAGAATTCGTCAATTGAGTGCTCGAGGTCACTCTGTACAGTGTGAG
CGCGGAAGCACCACGTTATTCTAAGAGTCTCCGGGGGCGAGGCTCGGAAAGCTCTTTCCTCACAATTCTCAGATGTAAGACCGGTTTCGCTGCGGAAACA
AGCGAAATCTTTTGTGGATACCAAGCTGAGCGTGATCAGCAGAGTCCGCGATGCCATGGCAGCGGACCAGTATAGACAAAATAAGTACTCAGACAAACAA
GGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGAACTTAGTGCTATTAGACACGAGGAGCCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGC
TGAAGCACCGCTTCATTGGACCATTTTCAGTCCTGGCCAGACATGATGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGCTCTA
TGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGTTGACTCGCGGACCCACCTTGCCTAGATCCTCGAAGCGAAGGGCCGGCCACAGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCACCTCTCTCAACGA
ATGACGAGGTGGCTGTCCTTCTTCGCAGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCAG
ACTACGAGTTGGACCACATCACACGGATGACAACGGATCTATATGATCGGATACTCATGGCGTATCGGGACGATGAGGCTGTCGCGCCAATCGTCAAGTT
CCTCACGGCAGGAGCGAGCGCGAAGTCCGACTGGCTTTCGTCGCGACAACGCTCCCGACTCCACCGATATGAGCGGACGGAAGGCCTCCTCTACTACTGG
GTGGAGCCCAATGAACCTCCACGGGTGGTCGTACCCAACGACGAGGATTG