Description :
From Genome Similarity Track
Location :
Scaffold_126:65394- 67649
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_13772transmembrane protein, putative

Sequence
2255 bases(100 bases per row)
GATTGGACCTGGGTTGAAAGTGGGCGTCGTAAGGTGAAGCGTGGGACTCGATGCCTGCGCTCGCACGTTATCGACTCGACAGCCGCACAGAAGGAGCCCA
CGCATAAACATATGTTGGCATCGTATTTTACGCCACCTGCGCCCACGGACTTGGGTGCGTCGAAGTCGATGCGCCCTCACGCCAATACGTGGGTAGTAGA
GCAACTATCGATCGATTTCTCCATATGCAACGAGATCCATGTCGGTGATCCTTCCTTCTGCGCTCGGACAAATCAAGGGACGTGGCCAGCCCAAAGAAAG
TACGACATTTTCTTTAGCGTCGATTTGTTGATTGGAATCGACGACCCACTTGAACAAGAACGTTGCCGTTCACTGGTGAATATGCGACACGTCCGCAACT
CAGATCCGAAACCCGGCTCACGTCGCGCCACGTCGGTTCTAACTTCCAAAAGGGAGCTGCGAGGATGCGCGACAAGAAAAAGAAAGGGACGTCGTCGTCT
TCTGCGCCATCGTGCAATCTGATTTCGCGATTGTATTCGTTGAGTGGTAGGAACGGTATCGTCTATAGCGTGAATAGAGGCGCGCAGGGAGGGTGTAGAA
GAACACGTTGGTACAACGCGCCAACGAGGTCACGTCTATTGTCGTCGACTCAGATGGCCCGCGAGACGTTCTCGACGCCTTCTTCCTCACTTTGCAATTT
CCTCGGTACCCGTTCAACATGAACAACCCCAAGGAATTCATCACGGCCGAGCGTGTCTCGTACGTGCACTCGATCGACAAGGCGGCCGGCGAAAACGCTG
AAGAGTATGAGGCCAACAAGACGCCCGGTGACCTCGAAGACGGCGCGCTCCGTGCCGGTGGTGCCCCGGTGTACATGTCGGCCGAATGCCTCTCGATCCT
CTTCCAGTATGCGATGATTGGTATCGTGTACGGTGGTGTCAACTCGATGCGGTACGCGATCGTCACGGGCTACTTCCAGCTCGAGACCAACGTTGGCAAC
TCGGCCCGAGCGCTCTTGAGTCTTGGCTGGTCGCTCAAGGTCGTCTTTGGCATGTTTAACGATTGCTTCCCGATCTTTGGCTACTCGCGCAAGCCGTACA
TGCTCCTCGGCTGGACGCTCTGCTCGATCGCGCTCCTCGTGATCGCCATCAAAGACCCTGGTGAGCAGGGCTCGCAAACCGACGGCCCGGTCTTCATCCT
CCTCGCGGCGCTTGCTGGTTTTTGCTACGTCATGGCCGATGTCGCCCAGGACGCGCTCATGCTGGCGGTGGCCCAGCGCGAGCCCGACGCTGTCCGCGGT
CGTCTGCAGTCGTACTCGTACGCGGCGCGCACGGTCTTTTACGGCCTCATTCAGTTTGTGTGCGGTTACTGCCTCAACTCGAAGCGTTTTGCCGGTACCT
TTGACTGGGACATTGGTATCAACGGGTACTTTTGGATTCTGGCCATCCCGTCGTGCTTGAACGTCGTGGTGATTTTCTTCTTCGTCAAGGACGAGAAGCG
CGCGCGCATTCCGCTTGGCACGTACTTTGGTCAGTTCTGGACGCTTGTCCAGAAGCGCGCGGTGTGGCAGGTCCTCCTCTTCAACTTCCTCTTTGGTCTC
TTCCAGTCGATCACGTCGACGGCCGGTGACTACATTGCCTATTACTGGGCCGAAGTCGAAAACCTCAACCAGCAAATTGTCGGTGTCGTGAGCCAGTTCC
TCTTTGCCGCTGTCCTTACGCTCACGGGTACCTACGGCACGCACTGGAACTGGCGCTTCGTGCTCGTCATCACGATCCTCGTTACGTATGCGATCGACTC
GGTCTGCCAGTTCTGCACAATCTACGACGTGGTGCGCAACCAGTGGTTCTACCTCGGTGTGCCGCTCATCGAGACGGTCCCGTCCGGTATCAACTTTGTC
GTTGGAACGTACGTCATTGTCGAGCTCGCCGAGGTCGGTAACGAAGGCGTCATGTACGGTCTCTTGACTACGGTGTCGAACCTCCCGGGCACCTTTGGCA
CGATTCTCACCAACATGATTAACGGTCAGCTCAACTACGGCAAGGACCTCATCCATGACGATGCGCCCGAGACGCGTAACCAAGTCGCCTACTCGTACAT
CATCTCGTACTCGTTTGTCGTCGTCGGCTGCCTCTGGGTGTTCCTCCTCCCGCCGCAGCGTGCGGCCGTCGCCGAGCTCAAGAAGAACGGCGGCAGCTAC
CCCAAGGTGGCCGCGCTCATCTTTGTCGGTCTCTTCATGGTCCTCGTCACGTCCA