Description :
From Genome Similarity Track
Location :
Scaffold_29:653842- 661585
Transcript NameFunction/comments
Phyin_T30-4PITG_13512Peptidyl-prolyl cis-trans isomerase B
Phyin_T30-4PITG_13513Putative uncharacterized protein

Sequence
7743 bases(100 bases per row)
GGGTGATGGCGCATCGCGTGGATCTACCTCACTTCAGTAACCACACGAACAACCGAGTGGAAAGTCTGTTCGGGAAGCTGAAGCTAACGTTGAGAGCCAA
GCTTACAATGAAAGCTAGTTTGGTAGCCGTGTTGGAATACCAGAGACGCGTGGAGAGGGATTATCAGTCGAGGGTAGAAATGCCAGGAACTTCGCGCGAT
GTGGCATTTCCTGAAGAGATGGACGTCGTCTTAGGAATGACTACGCGCTGGGTGGCAGACGCAATCATGTCCCAGTACGATGTGACCATGGACTCATCGC
TTTCCGACTCCTACGCTTTCAGAGACAACGGAGCTACTGTTATTGTTAGACGAACTGAACGAGAGTTTCTTCGTGAGAAGGAAAGCTGGAAATGCGATTT
CGAGTTTTCCCAGACAATGCAGCTTCCGTGTCGACATGCGATGATATTCAGGAAAACGTGTGGACTCCCGTTTGTCTTTCCCTACGCTGCAATTGCAAAC
AGGCAAGTGCATTTACTGACCAGGTATTGACCAGATTTTATCCAGGGTTTGGCCAGGTTTTGATGTTATGCATTACTTCACTAACGCATTGCTTGGCATA
TCACGATTAACAGATGGTTTGGACGGAGTCACAGCTCACCGGTGAATCTACCCGAGATACCCGAACCGCTCTTGGTCAAAACATATAAAGTCAAGATGAG
TGCTGCGTCAGCGACAACTGGTCTTAGTGAGCCGGAGAAGTACAGACGAGCCCAACAAGTTTTTGCTCGCATTGGTGGTGAGCTAGCGCGACTTGAAGAC
GTGGAATTCGGCACCGCCCTAAAAAAATTAGAACAGTGGTGGTACAGCTTGAGACAGGGGGCTCAAGCTGCAGCAGAGCAAGGAGAGGATTCTGGCGTCG
TTTGTGGTGATAGTAAGGACGATCAGCTTGAAGGAAGCGATACAGGGAAACGACCCAACAGACTTGCGGACAATCCTGTTCGAGAGCCGTAGGGAAGGTA
AAAGATGGTACTGGATCGAGGGCTTTGGTACCAACCGTGCGGCTTTCTGGTAAAGTTCGAAGGGTGAGCTGAACCGGACACAGACGAGAGAAAATGCCAG
AATATTCCTCAAAGAGTACAGCCGAGGGATGAAACTGAGAGTTCTTCTTCGTGAAAGTGACGTTTGCGACGTAGTCAATACATTTAGGGGGAATATTGCC
TGCTGTGCGTGAAATCGGGTCCTATTTGGCCACTCTTGAAGTCAAGAAGCGTGCAAACAAGCGGGTGGCAAAGTGGAGTACCGACGACGAATTTGTACCA
TCTCGAGTATCACAGAAGAAGAGATCAGCAGCGTTCTAAGCCTTCTGAAAAACGAGAGATTCGATGGAGAAGCAGAGATTGAACTAGCCATTGACGGAGA
GCGAACGGGTAATTGAATAACTTTGTGATGACGATTAAAAAACTGGGTCAGTTTACTCGCGAGCAATTGGAAGCCACGCAATGGCTTTGGGGCTTGCAGT
CGGTTTGCAGAAAAGCTGTATTGTGCTGTACGTGGCTTACTCATTCTGTAAAAAGGAGGAAAATGACACTGCACAGTCACAGGTGGCGTTACTACAGTTA
TTGGATTGCTGGTCGTACGCGGCGTTAAAGGGGTTCGAATTTGACCTGACTTACGCTGATCTATTTTGCTTGAGGGACTCGTAATGGCTAAACGACAACG
CGAGGAGCGGTGAAAGTGAGCTTGTCGCGTTTCTAGAACAATAACACTGTGATGATGCCTCCTCCTACAAACGATGAACGGCGAGGAGAAACTCTGCATG
AAAAAAATACGATCGATTTGATCGCCCAGTCGGTATCTTCGCGACCTTTCGTTTTAATCATGGAGGTGTGCATTGGGCGTGCATTGTCGTGGATAGAAGC
GAAAAGAAGGTAAAGATTTACGACAGCTTGAATGGGATCAAGAACCGAAGGATGCTAAACAAGCTGGCGGGTGACATCTTAGTGAAGGCACTGAAAGGAG
ATACGCACGAACAGGTGAGTGTTACGGAACTAAAGCAGAAAATGGCAACAATTGCGGGGTGTTCTTGTCACTGCTCTTTCTGGGTGATGAAGCCCCAAGT
GACCTGTCACGTTTTGGCATAACGAAGCTGCGCTGGGCCCTGCTACAAGCCATTTTGAAGATGAAGTAGCGTTAGTTAAGAGACTTTAGTGTCTACATTT
TCAATACATGTTTAATAACTGGATAAACCTGGAAATACCTGTGTTTGTGTGATGAGGACCTGAGCTTATGGTGCTGCTGAACTTGTAGCCGACACAATGA
AGTGATTGCCATTCCATCGTTTTTCCAAGTCGGACACATGCTAATTGGTCAGGTGTAATACCCGGACCACCTTCGACCATATTGGTTGGCTGCGAGACAT
TCAGCTCTGACCACTTCCATTGTTTGTTTAGCACCGCATATACGTATTGTCCAGATACTTTCACCTGAAAAATCCCTGGTAGTGAAATATACTAATCCAA
AATAAATTACGCCTTCTGATTCCAAGAAACCTGCTGATTAATAATACATGGCGAATCAGAATTTTTTTATCTAGAAAACCTGGATGCGAAGGTCGTCCGG
GCAATTTAAGATCGATATTTCGACATTAGCTTTTACCAGTTATGAAATGTATTATTTATTTAGGTCACAGCAACTATTGTGTATACAATGTATACAAAAC
ACATTGTGTGGTTCATCAACCCTCGTTTGTAATCAAATCTAACGCTATGGCGTCTCTATTGCTGCGTCCATCGCAGCTCCTGCTGCGCTCTCAGCGTTCT
GCGCACTCCTCACTGCTCCACAAGGCACGTTAGCTACATCTGTTCCTTCTTCCGCGGTAGCGCCATTGAGATACTGATCCAGAACGTCATCCTAATTGCT
CATTATTCTTTTTCAACATCAGGCAGCAGCTTTTAGCTCATCCGCTGGCAATTCCAGCTCACCATCGGGTCTTACGTCGCTGCAAAAGGCGTCGCTGGGC
CTGGCCGTCATGTTTGGCGGTGGTTATGCCATCGGCTACTTCTTCGGACCTTTTCCATCGCTCGAGGACCTCACAGGCGTCAAGGCTGTGGGCGGCGCCC
CTGCGTACAAGGGCGAGCTGATCGTGACCGACAAAGTCTTCTTCGATATCGGCATCAACGACGACTACGTGGGCAAGATCGTTATGGGGCTATACGGAGA
AGTGCAGCCTCGGACGGTGGAGAACTTCCGTGCGCTGTGTACCGGCGAGAAGGGCGCGTCTCGTGCTGGCCCGCCGCTGTGGTACAAAGACTCCAAGTTC
CACCGCATCGTCCCCGGCTTCATGTACGCTCTGACTATTATTTTTATGTATATTTTTTAGAATTTCTTAGATAAACATATTTTTTATAGGATCCAGGGCG
GTGACTTCACGCAACATAATGGACGAGGCGGAGAGTCCATTTACGGCCGTCGCTTTGACGATGAGGACCTGAGTGTGCCTCATGCGGGTCCTGGCACGCT
GAGTATGGCGAACGCAGGTGCTAACACGAACGGCAGTCAGTTCTTCATCTGCACGGGTGACACGCCATGGCTGGATGGCAAGCACGTCGTGTTTGGACGC
GTGCTGGAAGGGATGGACGTCGTGGACATCGTCTCGAGCTGCGGGAAACGCTCGGGCAAGCCGATGGTCGACGTCAAGATCATCAATTGCGGCGTGTTGG
ACGACCAGGGCGTTGCCGCTGACAAGAAGGAGCCCAAGCGCTTGACACGCGACGAGATGCAGGATCGTCTGGACTCGCTGCGGGAGGTGGAAGGCAACTT
TAAGGCTCAGAAAGACCAGATCGACCCCAGTATGTACGACCAGCTGATGGCCGAGATCAAACTTGAGAAGGTTCGCATTAAAAAGGAGCTTAAGAAGCCT
CAGCCGAACGAGTAAAGAGGGTTAAAGGAATACTGGTAGTAGTTCTCAAACCGCGCCTTCAATTCGTCTAAGTACAGTACCGGTATTAATACCTTCCATC
CTTTCGACAAAAACACGATTTGATCTGGCCCCTACGTAAGGGCTCCGATTTGGTCTAAAAGGTACCTTTTAACAAATTAAGGGCTAAATGGCCAGTATTT
GCCGGCCATTTACCCTTACGTAAGGTATCCACAACAGATTGATTTAAAATCAAATATGGGCTACTCGTCAGACAGACGCTGGCGAGGCCAGAGAAGGTGA
ACAAGCTATTGCCTTTCTACAGCGCGTCAACAGTCTCTACGCAGATTTTCCTTTAAGAAATGCTGCAGCGGTGGGCGTGGTATTGACTGGGTACTGGGTT
TTTTAAGAATGATAATATCAACACCCAGCAAAGCAGAGCTCCGCCAAGCCAGCAGCCGATTCTAGTAAGCTCCCTCACCATCACTTCAGAACTATTTGGG
TTCTGCGTCGTGGTTACGTGACGTGAATGTTTGTGCGCCTTTATCAGTTATCTGACGATGAGTGAAGGGATTCTCGCAATTGACCGTTCACCGGAAGGTA
TATTTGCTGACCGTTTATAAGTGGAACTTACCCACGTCCAGTGCGGTTCACATGCATAATGTTTGCAACGGTAAGCCATGATGCACTAAGCAACACCCAA
AACGATGCTCTCTGGTGAGATCCAACGCTATTGGTCTCTGTTCGTGTCGTGACTGTCCCGCTGCCTGTTCCGCTGCTCGTGTTAGTGGTAGCTGGAGTGT
CGTCGAATGTTAGCAGATCACTGTTTGCATCGTCTCCTTCACACACAACCAGCGGGTCTGGACATGTGATATGTCCAGAAAAGCCTGGCACGGAAAATTT
CTCGCCCTTGCCAGTGCAGTTTAGACTTACAGAATCTTGCGTCCAACTCCGTGGAATCGTGAGTTGTACAAACAAACTCGCGTTCGCATTAGAGAAACAT
CGCATGCCGTAGCAGCCACTTTGTCTTGGCGAACTCACCGTCCAGAATTGTGCAGAATCATCGCTACGGAGTGACGTTTGTATGCATTTACAAGTGGGAC
AGTACGTCTCACCTAACGTTGACGTTAGTCTCGCCAAGTTGCAGAAGGTTGGCGGAAAGGGAGCAGTCGCCAGCCGTGTAGCCCACAACTAACGGGCAAT
AATCGGCGAAGGTATTAGTTCCTCCTTTTCTTGGGTTACCGGGAAAGTACTGATACTCGGTCGGAATGGTTTGGCTTTTAGTGTTTAGAGAGTATACCGC
GCGAGACGTAGCGTCGACTGAACAGCCCTGAAAGTCCGTCGAAGAAGTACAGAAATGATCTGCTGCTATCGGAGCTTGCGTCACTGGATCGATGCATTTT
TCCGTCGCAAAGGAACAACCTTTGCTTCGACCATAATGCATAACCTCCGACATGGATGCATTGACTCGATACCAACCGGAATTTGCGAAGAACGTGAGTG
TGAGAGCACTGAAGACGTTGTGGTAGCTGTCCACGGGGGTCATTAACTCCGGCTCGAACAATCGTTCTTCCCAATGAGAACCAAGACAGCCGCTGTCTTG
AGACTCAATCTCGGCACCTTCCAGTGTTGAGCAGTTGAAATGATCACGAACAACGCACGGACGCGTGGAGTCACTATTTTGGCAACAACATGATCCCTCT
CGGTTGAGTACTGGATCGTAGTGTTAGAAGGCTCCACGTAGTAGTCGATCTCCTGGCTGTAGGGCCTCCACAATCAAGTATTAATGGATCATAGTCGGCA
AAATCAAACAGTGTTATTGGTCAAATATCATTTCATGTCAGCCTTTAACCCCCCAACGCCCAACGGTTGTACGTACAGGTTGTACGTACAACATGTTAAA
AGTTGGGCTATTTTGTTGCAAAATATGGGCAAACTTGAGAATGCACAGGGCTGGGGTTGTTGAGATCAGTCTCTTTGGCAATAAATAATACAGATTCTCC
CCTGGGTTGGTGGCTGAGAGCTCATTTCGAGAAAAGACCTGAAGGAGAGACACGTGTGCACGATGGCCCCGCCTCGAGAAACACACCGCGAACGCCAGCA
GTTCCTGCAACGTCTGGATGGCCGAACTGCGCACGACCGAGAGCGCATCAGGAAGGAGCATGCGGCGTACCTGGCTGGCGGCCGAGAGGAGGATGCTGAC
TTCGGAGAAGATCCAGCACCTACACGCAGCGCGACAGCTCGTCCTCTGCTTCCGGTTCCGATCGGCAAAGATGCCTGTTACGTGCGTGCGCAGCGACGTT
TGATCTCGCAACAGCAACGTGCTGTCGCCGCAAAGACGTTGGCAGGCTCCGGCAAGAAACGGTTGGCTGCTAGTAGGGACTTGAGCGACGATGATGAGGA
CTATGATCCCGATCGGTTCGACGAGGAAGCGGATGCTGATGCAGACGATGAGCGACTGGATGCAGCAGACTCCCCAGTCAAGACACGGCCGCCAAAGAAG
AAGAAGAAGAAGACGGCCGCGGCGACCCCGACCAAGAAGGCGACCCCGACCAAGAAGGCGACCCCGACCAAGAAGCCACGAAAACCCACCGCGTCGCAAG
TTGCTAAGGCAGCGGCAAAAGCAGCGAGGACAGCAGCTGCCGAATCGCGCTGTGAAGATTCGGCGAATGCCGAGGAACAAGGGAGCATCGCTTTGGCCGA
GGCCAGGAAGAGATTGGAGGCGATTTGTGAAGCGAACAAGAAGAGGAGCCGCCAACCAAGTGGGACACCAGAGAGGTACACCATGTTTTATGCTGTCAGA
TACTACATGTTCTCACGAAGTGTTGTTGTACGCTGCGCAGGTACATACAACATTTGGGACATACAACATGGATACAGCGTCGCTATGCTTTCCCTACAAC
GTCGTTATCGACAACATGTAAACAACATGAACAGCAGCTAACATATATTGTCTATCGACAGGGGTTCCACCGATCCTCAAGATACGTCAGAAGCACCGTC
GCCTCGAACGTTGTCTGCAGCGCCTGCGCCACCCCCGCCTCCTGAATGTCCAGATCCTGAATGTCCAGCTCCTGAATATCCAGTTGCAGCACCAGAAGAC
GATTGGTACGTGGCAAAGTCTTTGATGCTGATTATGTATACTAACGTTGTGCGTATCATAGTGAAAGCTCAGCATCCATTTCCCAGACTCCTGTCCCCGA
CGCGGCAACCTCTACCCCTGTTTCGCCGACTTCTGCTCCAGCCTCGCTGTGTTCCGCTCCAATTTCACCTGAAAGAACGTCGGTCTCAGCCTCTCCTATC
GCTGCCCCCGCTTTCGCTGACGAGTTTGATGCGTTGAACTCTGATTGCGAGGAAACAGAGACCGAGATTACGTTTTACGATGATGATGACGAGTGGAGTC
GAGCGAGAAGTGAAGGTGAGGGCTTTGCGTCGGGTGAAGACTACAGTGATGAGGACGATAGTGAGGCTGGATCAGATACTATGAGTGCTGATGGAGAAGC
AGCTGGTTCGACACAGCAGTGGAGCGTCTTAGAGAAGCCGGAAATGGTTGATTTTGTGATGGACGATGCCAACATGGCTGCCATGCGAGCTAACGGGTGA
ACTTCGGTTCGTGACAATGAGGGGTGTAGCCTCCAACATATTCTAACATGATATATGATGTATATACAACATGTAGACCCAGACAATTTCCCGCCTGACC
AACATTACCCAGGATTATATTCTGGGGAGTATGGACCAACCGACGAGGTACTGGCCCTGACACACTCACCGCTCAAGCTATTCTTCTTTTTCATGCCGAA
GAGTTTGTGAAGACAAGTTGCAAAGGAAACCAATCGCTACTTT