Description :
From Genome Similarity Track
Location :
Scaffold_14:65375- 68171
Transcript NameFunction/comments
Phymu_g1013hypothetical protein PHYSODRAFT_466812
Phymu_g1014conserved hypothetical protein

Sequence
2796 bases(100 bases per row)
AAAAGGATGATCACTGCGTCTGTGGGCGTAGACTCGAGTCTGTTGCTGGAACCGGCGCGTGAACTACTGTTCCCAGTGCCGGACGTGACCACGGAGCATC
GACCACGCTGTAGCCTCACGCTCACCAATCTATCGCCACTCAATGACGTGGTCTTTCGAGTGCGGACGCGCAACCCGGACGCCTTCACAGTGCGGCCGAC
CCACGGGTTGGTTGTGCCCGGAGCTAGTGCTCATGTCACCATTACAGCCACTGCGAGGACCTGCAAGCGTCTGGGCGCCATGGACCCGCGGGACTTGATG
ACGCGCCAGTCGTCCGAACTTTTCCTTGTGCAGAGTGTCGAGAgagatgaagacgtgcaAGCCGTGGAGCCACTGGACCCTCactccagcacgtcgttgC
GTGCATTCTGGAAGACGGTACCGAAGGACTGTATTACGGAGAACAAGATGGTCTGTCGCTTTGCCGCCTCAACGCCGGGGGTTCGTCCTCCGCTGCCTTC
GGAAGTCACACAGGACAGTAACATGTTCTCGCGTAGTATGAGTAGTGCAAGTATCAACTCGCAGGAATATTGGTCCAGTCGGAGTGAGAACAGGAGCTTG
AGTATGAGCGCGAGGGAGACCCGGTTGAGtcgcagtggaagcagcagcgaacggAACAGACTCAGTCGGTCTTTTAGCAATCAGTATGACGACGTGAGGA
GAGAAGATCGTCGCAGTCGCCAAGAATCGTTCGTCAGCGACGCTAGCAACCACACGACCATCGAGCCACCGACTCCAATCGATAGAAGGCCGGAAGCTAG
GAGGGTATCGGCAGCGACTTCTACCGTGGATAGAAGATCGGAGGCAAGGTTGTCTTCATTGACTGACTACGGACTCTCAAGGACAAAGCTTCGTGACACT
GCAATTAGCGGGATTAACGTGAACGACAGCTCCGTCAGCGATACGATGCTGACTGCACGTTCCACTGACAGTGCGGCAGGTGAATCGACGCACGAACTTG
GTCCTCTGCTCTACCTCATTCAGCCGGACGATATGCTGTCATTAAACGTGAAACCAGCTCCGCGCTTTTGGGGGAaaacctccttcttcatcgtgaacTC
GAGTCAGAATGATTGCCTCACCTTCAAGGTGCGCACCTCAAACCAGTCGGGCTACGTCGTTAAGCCCAGTCGAGGGATAGTGTCAACAACGAGTGCGCAG
GAAGTGGTCGTATCGTTGTGTGCACCTCGCGATGAAGACTCTTTTGATCCCGACAAGCGTGAGGCCAAGGACGGATTTATGATCGAAGTTGCTAACATTT
CGCGGGACAAGTACGCAGATTTGATAAAGCTGGACGAACGGAAACGCACGCGTGAACTCGGTTCTCTTTGGTCTCTTATGCCCCGAAGCAACCGACAGTC
GACGATGTTATCAGTGAATCTCAAAATGGAGGGGAGCGAGTGTGACAGTGGCACTCATGAAAGCTCCGAAAGTGGTCACTCGGATGCTCAAAACTCAAGT
ACTTCAGCTTCCAAAGAAAAgatggaagaagctccaagGCAAAGCTTACGTTCAGTTGTCAATGggatgaagcagcttcatAGGGCGAACCAGTCATCTG
ATAAAACCGCTGGGAACAAACTCCACTCTATCTACCGATACTCGGATTCGGATGAGTCTGCCTTCACTATCGCTCCAACTCCCGTACCAACCGAAATCGG
TGATGaaagcgatgacgaagtgGTTTTTCCTCGACATAACGCAGCTTCTAAAGCTCCTCAAGACTCGGCTGTGATTGTCGTCTCAGCCGACAGGATGGAT
ACTGTCGACTTCTCCAACCCCAAGTTGTCCTTCTTTATTTAGTTGCTCTTCATCCTgcagacgatgacgaagactGAACATTCACGGAGTCCATAGCTTT
CCAAAAATGTATATTCGTGAAGTTATGAATCGCAGGTGTTTTTCTCGTCTGCTTCTTGTAGGAAAGGTCGGTTACACGAGATGCTTCCATCCTAAGATGA
TGACTCAAAAAAGCCTCTCGTGTTGGGTCTAGCTACTGGTGTCAGTCAGGATCGCCTCCAAGTTCTCGAGGACCTTGACCGTTGACGACGTACCGAGCAT
GTTGATGATGCTGGGTGGGATGTAGCCCGCCAGATCGGCATGGGCCAGAAGAGTCACAACGCAGAACACCTTGCCCTCCTCCTTGAACTCCTCGATGATG
TAGCCCGAAATGTAGTTGTTCGCACGTACGTAGCCCTCGAGAGGGGCGACTTCCGCCACATTGACGGAGCGAGTAGCAATGACAACTCGGCCATCCTCAA
GGGTGGTAGCATACGTGACTACCACGAACTCCCGGCCGTAAATGGGGAACTGGCCCTTGCTGGTGATCTGACGGAAGGCCAAGTGGTTGGACTCGCCAAT
GTCGCGCAAAGTGACCACACCCTCcatcatctcgtccagctccagcgtgCGGTTGGGGTCCAGCAGAATCTGCTCAATAGCTCTCTTGTCGGCGTCGATG
CGGCGTGCGGCACGGAACGGGCACCAGTCGCACTCCTCGACGGCCCCGCGCCAGATCTTCACGCCATCGGCGTCCTCTACAATCTCCCACGTAGTCACCT
TGTCGTCTCCGGTGTGGCGGTTGAGCAGAATCTGGATGTTCTCCTTTCCGTAGGCctcgaagtccacgtcgttgGCGGTGGGGTACGCGGGCTCCTCAGG
CTTCACCTGCTCTTCGGCTGCTGGCGTCTCTCCGTACCCGAATAGGTAGTTCATAGTGATTCTTGGTGCAATAAAGAGGTAAAAGGTTGGGGACTC