Description :
From Genome Similarity Track
Location :
contig_24:653741- 661739
Transcript NameFunction/comments
g5779.t1hypothetical protein
g5780.t1hypothetical protein
g5781.t1hypothetical protein
g5782.t1hypothetical protein
g5783.t1XP_009529787.1 hypothetical protein PHYSODRAFT_508840 [Phytophthora sojae

Sequence
7998 bases(100 bases per row)
ACTATGAAACGCTGATGGACAGGGCTCCATCCTCGCAAAATGCTACGCTAATGTTTTCGTGATGAGAGTAGGCGGAAGCAGTTAGTTGGGATTCGTTAGA
TACTCTGATGCGACCTCGCTGAATGGAGACGCGTTGCTTGCCACCGCTACCAAACACTGGGGAAGCAAAAAAAGCACTCGACCGAGCTATTGCTTCGCCT
TCCTCATAATATCGCTCGCCAGCGAAGTCTCTCGCTACCGGGCGACCTGGCTGATAGCTGCCCCTCTGCAGCTGTTTCTGGTGTTTTCGAAGATGTTTGG
CTTGCTTGGGGTCGCTCTGCTGGGACGACGTACGTCACTACTGGTACTGGGGGTTATGAAAACAAACGAGCTCCTGCGTCTTCGTCGAACGCGGGGCTTT
GAGATGATGGACTGGGATGACAGGGCAGGCTATCGCCGCCGCACAACGAATCGCTGGAACAAGCTACCGGTTGATTGTGTCCGCTCGGGAACTTCGTTCG
CCCCCGGCAAAGAAGCCGCCTTCTGAGTTTTGCTGGTCGTGAACGGAAACCCGCGACGCGTAGTGGCTTCTGTCCGCTCCTTTCTTCGGCAGCTTGAAGC
AGAGACTGGCAGTCGTGGAAGCGCAGGTTCTCGGGGCTCAGCACGTTGTACACATTGTAGTCGTCTTGGGGAAGGTTCGCTGGGTGGGACGCATTCGGAT
ACGGCTCCGGGTGCGGGCCAAACAAAGTAGTGCGGCAACACTGGTGTAGTACCCTGACTTCGACTGCGCCATGGTTGCGAGGTGAAGACCATAGCCCGCC
AGAGATGAATTCGAAGAAACGGTCGAATAGTTGAGTGACGCCACCGAGTTGCTGTGCTTGAGAAGATCAGATTTCAGTCCACGTGACAGCGGTACCGAGT
GTCCAATCTGGTTGTTACCGTCGTACTCATCGTCAACACTAGAGCCAAAATTTGTGACGGATGCGCACACGGCTAGCGAGTCCAGCGAGTCAATCGCCGA
AACATGTTCGTCAGCATCGGTTCTGTTCTTTGAACGTAGAGACTGGCGCAGCTGGGTAACCTGGTCATCTAGAAGCGATTCTAGGGCCGTTGAACTGTTA
CGGTTGTTGTTCGAGGCAAGGTCATCGGTTGTAAGCTCCACGTCGCTGGGGTATCTGTTGTTGTTGTCGCCGTCCCGCTCGAAAGGCGGGGGCGACGATG
TTTTGCGCATCGACTCTCCTTCCGTGCTCGTGTCCGACATGCACTCTTCGTCCATTCCACGCCAACGTTGCCGCCGAGACTTGACGATCTCATAGCCAAA
GCCGTATTCCCCACCGCTCGTCATTTCATCGGCTGTGGGTGAGTGAGCTTCCGACTGTTCTCCAAAGATAGAGTTAACGTCCGAATTGTAGTCATGCAGA
GTAGGCTCCGAAGACGCGCCAATCAGTTTCTCCGTGTACTGCGTCAGATTGTCAAGCTGCGATCGCAGCATTGTCGAGCGGTTAATTTGCTGTTGGAGAC
GAATCTCCAACATGGCGTTCTTCACATCAAGGCGTTCGCTCTTTTGGCACACAGCCTCGTACTTCACCTGCAGCTCCGCGTACGCTTTCTCGACCTCGTG
GTACTTCTCCTCCAGAGGCGTCTCTACGGGAGCAACAGGTTCTGAAACAGAAACGTCGCTCAATCTAGGAGCGCTAACAAGTCCAGCAGTGTAAGGGCTT
CAATCCACTGAGCATTGGTAGTCACCATCTTCTCGAGCACCGACTTCATCTCCTGGGTCTCCTTCTCGAGGAACTCCAAGTGGTGGTCGAACACTGTTTG
GCTTTGGTTGTTGTGGCTAGTTTGGTTGTTCACCGGTCGAGCTGGCGACGGAGCACGCATGGAACGGGACGAAGGTGACGATGCCGACCGCTGGAAAGCT
GCGAACACGGGCGACTCCTGCTGCTGCAGCTGCTGTTGCTGTAGAGAAAGGCGTTGCTTCGTAAGGCCAACAGACGAGCGGACGTCGCCCGCCGACTGGA
ACGGTCTCCGGCTAGCTAATTTCCTGGCTGTCTGCCGTCGAGGGGCCTCCAGGACACGCGAGGTCGTGGGCCCCATGGACACCGACAGTCTTCGCGCTCA
GGGGACTCTGGCGACAGGTCGGTGATGGTGAATCGGCCTCGGACCTGCGTCTTGCCCTTGCGCACGGAAGAGCTGGAGGCCGATAGGTCTTCGCAGTTGT
TGTTGTCGTCGTCTCGCGGCTGCTCCGACGCGTCCGACATGGCGCTGAGCGACGCGCTGGGCGTGAGCACGTCCAGCTCGTCCTCGGGCACGTCTGTGAC
TACGAATTTGCGCGGCGTGCGCAGCTTGCGGCCAGTGATCTTGGGCACCGAGCGGCGGCGCTGGTCGGCGGCTGCGCGCCCCAGGGGCGGCTCTGGCTGG
CGCACGCTGGGCAACGAGACGGTGCTGGAGGTCGTCATGAGCATTAACTGCGCCGCGTCGGGCGCGGTGGTGGAAGAGGTCTATCTTTCCTGGGAGGAGA
GAAAAGCCGGAGCCGTTAATACAGGGGGCGGACGCCGCGCTGCGGACTCGCCACACTTCGCCTTGATGCGGAGGTCTCCTGTCTGATACTAAGTGCCGGC
ACCCCTTACTTGGGCCCATACAAGGGAGAGGGGCTAGAATCTCGACGATAGACCAGACGGGTCGGGTTTGGAAAGGCTGGTGCGGGTTTTGGGGTGATTA
CACTTGGTCACTGTATGGTGTGTAGACCCGTGCTGCGATTGGCTGTAAAAATAAGCTGAAACTGTGATTTTTGTGGGAAAATAGAAAAATGGCCGGTAAC
CCTCTTTTTCAACGTGTTCGGGTGGGGCTCCGTTGGTTGTGGACACGCCCTCATCCCATACTGGTACAGCAGCATTGCCGCGATTTCTTTCGGAGTCCAC
GCTGCGTGCTGCATTTGAGCAGCTTTGACTCGATTTTCGGGTATTTCTGTCTGCCCGCTAGGATTTCGTTATCAAAGTGCGAAAATGCCGATAATTTAGA
CGGCTGGCCAACTTCCCGCAATGTGCTCCACTGGCACGCAGCTTGCGAGTGCGTTAGCGATTCGGCTGCTGGCATTTTCGCAGCGCCAACCGGTCGGCAA
AGAACAAACCACCTGATTCCAGCCAGCAATGCGCGCTCCCAGAGCATTGCACCGGGAACAAGCAACGCGGCTCGGGATCCCGGCGCGGCTGGTGGCGCCT
GCTGGCGGTGCGCCTGTGATCGATCCGATGCTGCGTGGCCCCACATTCACGCCATTTGGCACACACGAGCTCCGAAGGCAGGCACTCGTTTCAGCGGCAA
ATTTCATGGTCAGCGCCATCGGCCATTTCCTCAACGATTTGGTACAATTCGGTCTTTGTGTAGCGCACACCAGATTCTGACTCGCCTAGGTACGTTCCTC
CGGGTCGGGTCAAATCGTTGACTGGATTTTTACCAACCCGGCCCATGTGCCATTTGAGTGGTTCCGAGCAACCACTGGTGGAGCTGCAATAGGAGCCGAA
CGGGCAGATCAGGAGCAGTTCGCGTTTTCCTCTGGGCAAACTCAAGCAGGAAGGAGTTTGTAGATTACAGGAGTCTTTTGTGTGTTCCCTAGTTCCAACT
GGACTTCTGGCGAGATCTCTCTTTCACAGTGGAGGTCCCAGGGTCAAGCAACTCGCCCCGAAGCGGAGCGCGAGCGTTTTGCTGCCGCAAGGTGGCGGAT
CTCGCCCGCAAGCTCTGCGTCTTTTGTGAGGGATAAGCGACGCAAACAGTTGAATAGCGAAGTCTCGGCCGTTGAGCATCTGGACCGCCTGGCGACCTAG
GTTGCCTCGCTGGAAAACTTGCTCCGACTGATTGATGGCTCCATATTCCCAATCTTTTTTGCTAGTCACTTCGACATAATGCTGGAGACCAACCATGGAG
CAAACATCCTTGTCAAAAATGCATTTTCACTTGGCGCAGCTTTTTAAGCTTAGAAACAACATCAACTCAAGAGCGATGTTGCAGTCGAATTCTTATCGTA
AACGCAGTAGCTGGCACTGCAATCTCAAAGGCAATGTATCAACTTTGGTGCATCAGTTATTGTTAGTGTCGACAATCCGCAGAGCTTGCTATTCTTGCTT
CTGCTAGGCGGCACACTGCGTTTGTCTGCCACACGAGCGCCAACGACCATGGGGCTCTGCCCGTTGAGTCGCATGACTGCAGAGGACCGGGAGCAGGAGA
GGGTCGCCGAGTTTGTGAGGTTCGCTATCACAGCCGACCTCGTCAAGCTGCGAGAGATGATAAGCAAAACCAAGATGGATCCCAACGCTAAGGATGTGAG
TGGAGAGATGACACCTTTGAGCTTTGTCGTGTTCGAAGCTGATTGCCTGTTCTTCTTTTAGCGCTTTGGAATGAATGCTGTGCACTGGGGTACGCTCTGC
GCTTCCTAGCACTATAGAAGTTGCTCACTTTGTTCCTTAATTGTTCAGCTTCGTATGTTGGTGAGCTCGAGTGTATCATTGAGTTGATCAAAGCTGGAGG
TTCTCCCAGTGCGACAGATTCCAATGGCCGCAACGCGCTCCACCACGCTTGCCGAAAGGACCATGACGAGGTCGTTCGCTATTTAGTGTCCACTGCCAAC
GTGGACATCAACTCCCGTAGTGAGAACCAGGACACGCCATTGCACAAAGCAGGTTACGCATGAAAGTTTGGTTCATTTTTTATGTTCGAAGGGGGCTAAC
GTCGTTGCTGCAGTTCGAGGGAAGAGCGTCAGGGTGCTTGAAGTTCTACTAAAGCTTGGTGCAGACCCCAATCTCCGGAACGAAGTACGTTTGGCTTTAT
TTGAAGACTCCTAGGTAATTCACAAAATGCTGACTTTTGATGTGAGCTTAGCAAAACAGGACCCCTTGGAGGAACTGGAAATGTCCATGACGACATTGTC
GGTACGCTTTGTCGGTTCTGTATAGTGGATGCTTGGGCTTATGTGTAGCCATTGTAGACGGAAAGCAACGACTCAAATCTCGTGACGTCTGCAAGGATAT
CAACTACCCAAGTCTATCGCGAGCCTCGCGACTACATTGGGCTTGCGCTCCAGCCGATAAGACGCGGAAGCGGAAGTCGCGGTGTGGATCGCACCGACGT
CCGAAGCTTCACGTCTCGTCGCAGTGTGACTGACTGTTCCGACCGGACAGGAAGGACGGGGTCTCGCGAAGAACCTACCGGAAGTCAGTGGGCCACTAGT
CCAACAAGCAAGCCAGCGGCACTATACATGTCACCGCAAGTGTCCGTCAAAAAGCACGTTCCGATGCGTAAGAATCTGCGGTACGCCGGCAAACGCGTCA
TCATGGCGTTGCGAGTGAAGAGTGCAATAATACCGGACACTGAAAAGAGGGAGCTGATGCGTCTGTTGCTCCGGAAGTACACCAACACACCTTCATCCAC
GACAACATAACAATTCATGCTCTAAATATCCCACCTGCAAACTATTTCCCCCTCAATAACAACCACAGTAACAACCACATTGAGACGTGTTTTCGCTTTC
GTGAAGCCAGGAGATTTATTGATTAAATACTCCCGTCTCGCTTTCCCACGAGGTTAGCAACAGCTTAGTTGGAAGCCTCGCGACGGTAGCCGTCCTGGCC
ACCGCGACGGAACTCGGGGTTGAAGTCGCCCGACGGGCCAACACCCTTCTCCTTGTCGAAGCGGCCACGGCCGAAGCCGCCAGCGGACGGGGCCTGCGGG
CGCGTGGGACGAGCAGCCTGCTTCTTGAGCGTGGCCGGCACGATCTCCGCGGGCAGGTGCAGGTACGAGCGCAGGTACTCGATGCCCTCGTTCGTGAGGT
ACCAGTAGAACCACTGCCAGTTGAAGGTCTCCTTGACGTAGCCGCGCGACTTGAGCGACTGCATGAGCTTGATGACCTGGAGGTTGGGCACGTCCACGGC
CTCGTGCTTGGGCAGCGAGAAGTCCTTCTTGGCGACCATCACGCCCTCCTTGAAGAGGTACGAGTACACAGCGATACGGTTCGTCTTGGGGACCAACATG
GTGACAGGTGGATGTCTAGAAAGCTTGCCGGCGAGTGCGGATCTTCACGGGAAATAAGCGGCGAGGTTTGCAGGAAAACCAGAATACTCGGCCGTCCACC
GCCATGAGCCCCAGCCAGCCAACCAATGCCGTGGGCTGTTCCCGCTACACAATATTGTGTATATTACGTAAAAAGTGTAATTACTCCCTTTAGCGTTTTA
GCCAATCGCGAAGCGGAAGGTCTCAAGTGTCGCCGATCGCGGTGTTAAACGTCTTGCGGTTGATTCGCAACACGCAGCAGTCAACCACCAATGCCTCTGG
ACCCGGCGGTGCACTCCGTGTTGGTGGACTTGGCCGCCGGCACCGTCGGCGGATGCGCCGGCGTCATTGTGGGGCAGCCGTTCGACACAGTGCGTGTGCC
ATTGCAGTGACCGTCTGTCTAGCGCCAGTATCTGACGCCTATGTCATTCGTGTTGGCAGGTCAAAGTTCGGCTCCAGATTCAGAGCAAATTCTACAATGG
TGCCTTGGACTGTACCCGCAAGACAGTGCGTGGAAGTTTTTTTGTAGTACAAGGTGGCGGTGGCATAACACTGTACGTTGATTGCGTTTTTTTTTAATTT
GCAGCTTCAGCATGAAGGCTTCCAGGGCTTCTTCAAGGGGATGACGTCGCCACTGATTGGCAGCGCTGCCACGAACGCCGTCATGTTTGCTGTCTATGAG
CGCACACTCAAGATGATCGACGACACGCCGGACAAACCGTCGCTCACTTCTGTGTTTTACGCCGGAGCTATCGGCGGCTTCTGGCAGACAGTTCCGTTAG
CACCCGCAGAGCTCATCAAGTGCAGACTGCAGGTACAGGACGGACGTAGAAGCAGCCAGTACCGAGGACCGATGGACTGCATCCGCCATATTATCAGGTG
CAGGGGCGTCTCCGGGCTTTTCCTCGGTTTCACATGCACGCAGTGGCGTGAGGTGCCGTCGTTCGCCGTCTACTTTTGGCTGTATGAATACACCAAGCGC
ATGATGCTCGACAAGGGTATCAACGACACTACGTCCATGCTGACGGCCGGCGGTGTTGCAGGTGTTGCCTCCTGGGTTGTTTCCTACCCCATGGACGGTA
CGTTCATCCTCTTGTTTTCAGCAAGTCGGCATTGTGTGTGGTGATTAACGTTGCTGTGTTGCTTTGCTCCGAGCAGTGATCAAGTCTGCGATCCAGACGC
TGCCCGTCAACCACAAGCCAGGCGAGCACAAGATAATGCACCAGGCTCGTGTGCTATATCGTATGGGCGGCTGGCGAATCTTCTTCAGCGGTCTGGGCAC
TGCTTGCGTTCGAGCGTTCCCATGCAACGCCGTGACGTTCTACGCCTACGAGAAGACCTCCGAACTGCTCAAGCAGGCCTCTCGAGACTAAAGCAGCAAC
GACGTCCTAGAAACCACACGTTACCACCTACATAGATCCCTCTTCAACATAGAACTTCAACTAATCACGTTTTATCTAGATCTAATTTTCAGGTTGAATC
ACGTTTGATTCCCGGCGGAATCACAAGTCGATCTTACGTTCCTGCCTCATGTTGGCCTCCCTCTTGCGTCTGCGCATGGCGTCCCCAAGCGCTGCTGTGG
TTCATCGTCGCTTCGCATCCAAGAACAACCGTGAGCACATTGCGGACTGGATGGCGGGGCCGCCGCAGCCGCTGGACGTGGCCTCCACCAAGTTTGACAC
ACTCTCACTTGCCTTCGCCGACGATGACGCCGCCTCTGGAGTGCTGCACTTGAAGCTGAACCGCCCGAAGGTCGTGAACGCCATGAACATGCAGATGTGG
GTGGAGCTGACCCGAGCCTTCGAGCTCGTGGAGCTGGATCCGAGTGTCAGGGCCGTCGTGGTCTCCGGGGAAGGCCGCGGCTTCACCAGCGGCATGGACC
TGGACGTCTTCGCGCAGATGCAGAAGGTGGCGATGGACGAGTCCTGTGAAGGACGCAAGCGCGAGCGTCTGATGCGCGTCATCGACAAGTTCCAGCAA