Description :
From Genome Similarity Track
Location :
contig_24:653729- 661727
Transcript NameFunction/comments
g5498.t1hypothetical protein
g5499.t1hypothetical protein
g5500.t1hypothetical protein
g5501.t1hypothetical protein
g5502.t1XP_009529787.1 hypothetical protein PHYSODRAFT_508840 [Phytophthora sojae

Sequence
7998 bases(100 bases per row)
GTTTTAACCAATCACATACCAAGAGGGACACTATGAAACGCTGATGGACACGGCTCCATCCTCGCAAAATGCTACGCTAATGTTTTCGTGATGAGAGTAG
GCGGAAGCAGTTAGTTGGGATTCGTTAGATACTCTGATGCGACCTCGCTGAATGGAGACGCGTTGCTTGCCACCGCTACCAAACACTGGGGAAGCAAAAA
AAGCACTCGACCGAGCTATTGCTTCGCCTTCCTCATAATATCGCTCGCCAGCGAAGTCTCTCGCTACCGGGCGACCTGGCTGATAGCTGCCCCTCTGCAG
CTGTTTCTGGTGTTTTCGAAGATGTTTGGCTTGCTTGGGGTCGCTCTGCTGGGACGACGTACGTCACTACTGGTACTGGGGGTTATGAAAACAAACGAGC
TCCTGCGTCTTCGTCGAACGCGGGGCTTTGAGATGATGGACTGGGATGACAGGGCAGGCTATCGCCGCCGCACAACGAATCGCTGGAACAAGCTACCGGT
TGATTGTGTCCGCTCGGGAACTTCGTTCGCCCCCGGCAAAGAAGCCGCCTTCTGAGTTTTGCTGGTCGTGAACGGAAACCCGCGACGCGTAGTGGCTTCT
GTCCGCTCCTTTCTTCGGCAGCTTGAAGCAGAGACTGGCAGTCGTGGAAGCGCAGGTTCTCGGGGCTCAGCACGTTGTACACATTGTAGTCGTCTTGGGG
AAGGTTCGCTGGGTGGGACGCATTCGGATACGGCTCCGGGTGCGGGCCAAACAAAGTAGTGCGGCAACACTGGTGTAGTACCCTGACTTCGACTGCGCCA
TGGTTGCGAGGTGAAGACCATAGCCCGCCAGAGACGAATTCGAAGAAACGGTCGAATAGTTGAGTGACGCCACCGAGTTGCTGTGCTTGAGAAGATCAGA
TTTCAGTCCACGTGACAGCGGTACCGAGTGTCCAATCTGGTTGTTACCGTCGTACTCATCGTCAACACTAGAGCCAAAATTTGTGACGGATGCGCACACG
GCTAGCGAGTCCAGCGAGTCAATCGCCGAAACATGTTCGTCGGCATCGGTTCTGTTCTTTGAACGTAGAGACTGGCGCAGCTGGGTAACCTGGTCATCTA
GAAGCGATTCTAGGGCCGTTGAACTGTTACGGTTGTTGTTCGAGGCAAGGTCATCGGTTGTAAGCTCCACGTCGCTGGGGTATCTGTTGTTGTTGTCGCC
GTCCCGCTCGAAAGGCGGGGGCGACGATGTTTTGCGCATCGACTCTCCTTCCGTGCTCGTGTCCGACATGCACTCTTCGTCCATTCCACGCCAACGTTGC
CGCCGAGACTTGACCATCTCATAGCCAAAGCCGTATTCCCCACCGCTCGTCATTTCATCGGCTGTGGGTGAGTGAGCTTCCGACTGTTCTCCAAAGATAG
AGTTAACGTCCGAGTTGTAGTCATGCAGAGTAGGCTCCGAAGACGCGCCAATCAGTTTCTCCGTGTACTGCGTCAGATTGTCAAGCTGCGATCGCAGCAT
TGTCGAGCGGTTAATTTGCTGTTGGAGACGAATCTCCAACATGGCGTTCTTCACATCAAGGCGTTCGCTCTTTTGGCACACAGCCTCGTACTTCACCTGC
AGCTCCGCGTACGCTTTCTCGACCTCGTGGTACTTCTCCTCCAGAGGCGTCTCTACGGGAGCAACAGGTTCTGAAACAGAAACGTCGCTCAATCTAGGAG
CGCTAACAAGTCCAGCAGTGTAAGGGCTTCAATCCACTGAGCATTGGTAGTCACCATCTTCTCGAGCACCGACTTCATCTCCTGGGTCTCCTTCTCGAGG
AACTCCAAGTGGTGGTCGAACACTGTTTGGCTTTGGTTGTTGTGGCTACTTTGGTTGTTCACCGGTCGAGCTGGCGACGGAGCACGCATGGAACGGGACG
AAGGTGACGATGCCGACCGCTGGAAAGCTGCGAACACGGGCGACTCCTGCTGCTGCAGCTGCTGTTGCTGTAGAGAAAGGCGTTGCTTCGTAAGGCCAAC
AGACGAGCGGACGTCGCCCGCCGACTGGAACGGTCTCCGGCTAGCTAATTTCCTGGCTGTCTGCCGTCGAGGGGCCTCCAGGACACGCGAGGTCGTGGGC
CCCATGGACACCGACAGTCTTCGCGCTCAGGGGACTCTGGCGACAGGTCGGTGATGGTGAATCGGCCTCGGACCTGCGTCTTGCCCTTGCGCACGGAAGA
GCTGGAGGCCGATAGGTCTTCGCAGTTGTTGTTGTCGTCGTCTCGCGGCTGCTCCGACGCGTCCGACATGGCGCTGAGTGACGCGCTGGGCGTGAGCACG
TCCAGCTCGTCCTCGGGCACGTCTGTGACTACGAATTTGCGCGGCGTGCGCAGCTTGCGGCCAGTGATCTTGGGCACCGAGCGGCGGCGCTGGTCGGCGG
CTGCGCGCCCCAGGGGCGGCTCTGGCTGGCGCACGCTGGGCAACGAGACGGTGCTGGAGGTCGTCATGAGCATTAACTGCGCCGCGTCGGGCGCGGTGGT
GGAAGAGGTCTATCTTTCCTGGGAGGAGAGAAAAGCCGGAGCCGTTAATACAGGGGGCGGACGCCGCGCTGCGGACTCGCCACACTTCGCCTTGATGCGG
AGGTCTCCTGTCTGATACTAAGTGCCGGCACCCCTTACTTGGGCCCATACAAGGGAGAGGGGCTAGAATCTCGACGATAGACCAGACGGGTCGGGTTTGG
AAAGGCTGGTGCGGGTTTTGGGGTGATTACACTTGGTCACTGTATGGTGTGTAGACCCGTGCTGCGATTGGCTGTAAAAATAAGCTGAAACTGTAATTTT
TGTGGGAAAATAGAAAAATGGCCGGTAACCCTCTTTTTCAACGTGTTCGGGTGGGGCTCCGTTGGTTGTGGACACGCCCTCATCCCATACTGGTACAGCA
GCGTTGCCGCGATTTCTTTCGGAGTCCACGCTGCGTGCTGCATTTGAGCAGCTTTGACTCGATTTTCGGGTATTTCAGTCTGCCCGCTAGGATTTCGTTA
TCAAAGTGCGAAAATGCCGATAATTTAGACGGCTGGCCAACTTCCCGCAATGTGCTCCACTGGCACGCAGCTTGCGAGTGCGTTAGCGATTCGGCTGCTG
GCATTTTCGCAGCGCCAACCGGTCGGCAAAGAACAAACCACCTGATTCCAGCCAGCAATGCGCGCTCCCAGAGCAGTGCACCGGGAATAAGCAACGCGGC
TCGGGATCCCGGCGCGGCTGGTGGTGCCTGCTGGCGGTGCGCCTGTGATCGATCCGATGCTGCGTGGCCCCACATTCACGCCATTTGGCACACACGAGCT
CCGAAGGCAGGCACTCGTTTCAGCGGCAAATTTCATGGTCAGCGCCATCGGCCATTTCCTCAACGATTTGGTACAATTCGGTCTTTGTGTAGCGCACACC
AGATTCTGACTCGCCTAGGTACGTTCCTCCGGGTCGGGTCAAATCGTTGACTGGATTTTTACCAACCCGGCCCATGTGCCATTTGAGTGGTTCCGAGCAA
CCACTGGTGGAGCTGCAATAGCAGGCGAACGGGCAGATCAGGAGCAGTTCGCGTTTTCCTCTGGGCAAACTCAAGCAGGAAGGAGTTTGTAGATTACAGG
AGTCTTTTGTGTGTTCCCTAGTTCCAACTGGACTTCTGGCGAGATCTCTCTTTCACAGTGGAGGTCCCAGGGTCAAGCAACTCGCCCCGAAGCGGAGCGC
GAGCGTTTTGCTGCCGCAAGGTGGCGGATCTCGCCCGCAAGCTCTGCGTCTTTTGTGAGGGATAAGCGACGCAAACAGTTGAATAGCGAAGTCTCGGCCG
TTGAGCATCTGGACCGCCTGGCGACCTCGGTTGCCTCGCTGGAAAACTTGCTCCGACTGATTGATGGCTCCATATTCCCAATCTTTTTTGCTAGTCACTT
CGACATAATGCTGGAGACCAACCATGGAGCAAACATCCTTGTCAAAAATGCATTTTCACTTGGCGCAGCTTTTTAAGCTTAGAAACAACATCAACTCAAG
AGCGTTGTTGCAGTCGAATTCTTATCGTAGACGCAGTAGCTGGCACTGCAATCTCAAAGGCAATGTATCAACTTTGGTGCATCAGTTATTGTTAGTGTCG
ACAATCCGCAGAGCTTGCTATTCTTGCTTCTGCTAGGCGGCACACTGCGTTTGTCTGCCACACGAGCGTCAACGACCATGGGGCTCTGCCCGTTGAGCCG
CATGACTGCAGAGGACCGGGAGCAGGAGAGGGTCGCCGAGTTTGTGAGGTTCGCTATCACAGCCGACCTCGTCAAGCTGCGAGAGATGATAAGCAAAACC
AAGATGGATCCCAACGCTAAGGATGTGAGTGGAGAGATGATACCTTTGAGCTTTGTCGTGTTCGGAGCTGATTGCCTGTTCTTCTTTTAGCGCTTTGGAA
TGAATGCTGTGCACTGGGGTACGCTCAGCGCTTCCTAGCACTATAGAAGTTGCTCACTTTGCTCCTCAATTGTTCAGCTTCGTATGTTGGTGAGCTCGAG
TGTATCATTGAGTTGATCAAAGTTGGAGGTTCTCCCAGTGCGACAGATTCCAATGGCCGCAACGCGCTGCACCACGCTTGCCGAAAGGACCATGACGAGG
TCGTTCGCTATTTAGTGTCCACTGCCAACGTGGACATCAACTCCCGTAGTGAGAACCAGGACACGCCATTGCACAAAGCAGGTTACACATGAAAGTTTGG
TTCATTTTTTACGTTCGAAGGGGGCTAACGTCGTTGCTGCAGTTCGAGGGAAGAGCGTCAGGGTGCTTGAAGTTCTACTAAAGCTTGGTGCAGACCCCAA
TCTCCGGAACGAAGTACGTTTGGCTTTATTTGAAGACTCCTAGGTAATTCACAAAATGCTGACTTTTGATGTGAGCTTAGCAAAACAGGACCCCTTGGAG
GAACTGGAAATGTCCATGACGACATTGTCGGTACGCTTTGTCGGTTCTGTATAGTGGATGCTTGGGCTTATGTGTAGCCATTGTAGACGGAAAGCAACGA
CTCAAATCTCGTGACGTCTGCAAGGATATCAACTACCCAAGTCTATCGCGAGCCTCGCGACTACATTGGGCTTGCGCTCCAGCCGATAAGACGCGGAAGC
GGAAGTCGCGGTGTGGATCGCACCGACGTCCGAAGCTTCACGTCTCGTCGCAGTGTGACTGACTGTTCCGACCGGACAGGAAGGACGGGGTCTCGCGAAG
AACCTACCGGGAGTCAGTGGGCCACTAGTCCAACAAGCAAGCCAGCGGCACTATACATGTCACCGCAAGTGTCCGTCAAAAAGCACGTTCCGATGCGTAA
GAATCTGCGGTACGCCGGCAAACGCGTCATCATGGCGTTGCGAGTGAAGAGTGCAATAATACCGGACACTGAAAAGAGGGAGCTGATGCGTCTGTTGCTC
CGGAAGTACACCAACACACCTTCATCCACGACAACATAACAATTCATGCTCTAAATATCCCACCTGCAAACTATTTCCCCCTCAATAACAACCACAGTAA
CAACCACATTGAGACGTGTTTTCGCTTTCGTGAAGCCAGGAGATTTATTGATTAAATACTCCCGTCTCGCTTTCCCACGAGGTTAGCAACAGCTTAGTTG
GAAGCCTCGCGACGGTAGCCGTCCTGGCCACCGCGACGGAACTCGGGGTTGAAGTCGCCCGACGGGCCAACACCCTTCTCCTTGTCGAAGCGGCCACGGC
CGAAGCCGCCAGCGGACGGGGCCTGCGGGCGCGTGGGACGAGCAGCCTGCTTCTTGAGCGTGGCCGGCACGATCTCCGCGGGCAGGTGCAGGTACGAGCG
CAGGTACTCGATGCCCTCGTTCGTGAGGTACCAGTAGAACCACTGCCAGTTGAAGGTCTCCTTGACGTAGCCGCGCGACTTGAGCGACTGCATGAGCTTG
ATGACCTGGAGGTTGGGCACGTCCACGGCCTCGTGCTTGGGCAGCGAGAAGTCCTTCTTGGCGACCATCACGCCCTCCTTGAAGAGGTACGAGTACACAG
CGATACGGTTCGTCTTGGGGACCAACATGGTGACAGGTGGATGTCTAGAAAGCTTGCCGGCGAGTGCGGATCTTCACGGGAAATAAGCGGCGAGGTTTGC
AGGAAAACCAGAATACTCGGCCGTCCACCGCCATGAGCCCCAGCCAGCCAACCAATGCCGTGGGCTGTTCCCGCTACACAATATTGTGTATATTACGTAA
AAAGTGTAATTACTCCCTTTAGCGTTTTAGCCAATCGCGAAGCGGAAGGTCTCAAGTGTCGCCGATCGCGGTGTTAAACGTCTTGCGGTTGATTCGCAAC
ACGCAGCAGTCAACCACCAATGCCTCTGGACCCGGCGGTGCACTCCGTGTTGGTGGACTTGGCCGCCGGCACCGTCGGCGGATGCGCCGGCGTCATTGTG
GGGCAGCCGTTCGACACAGTGCGTGTGCCATTGCAGTGACCGTCTGTCTAGCGCCAGTATCTGACGCCTGTGTCATTCGTGTTGGCAGGTCAAAGTTCGG
CTCCAGATTCACAGCAAATTCTACAATGGCGCCTTGGACTGTACCCGCAAGACAGTGCGTGGAAGTTTTTTTGTAGTACAAGGTGGCGGTGGCATAACAT
TGTACGTTGATTGCGTTTTTTTTTAATTTGCAGCTTCAGCATGAAGGCTTCCAGGGCTTCTTCAAGGGGATGACGTCGCCACTGATTGGCAGCGCTGCCA
CGAACGCCGTCATGTTTGCTGTCTATGAGCGCACACTCAAGATGATCGACGACACGCCGGACAAACCGTCGCTCACTTCTGTGTTTTACGCCGGAGCTAT
CGGCGGCTTCTGGCAGACAGTTCCGTTAGCACCCGCGGAGCTCATCAAGTGCAGGCTGCAGGTACAGGACGGACGTAGAAGCAGCCAGTACCGAGGACCG
ATGGACTGCATCCGCCATATTATCAGGTGCAGGGGCGTCTCCGGGCTTTTCCTCGGTTTCACATGCACGCAGTGGCGTGAGGTGCCGTCGTTCGCCGTCT
ACTTTTGGCTGTATGAATACACCAAGCGCATGATGCTCGACAAGGGTATCAACGACACTACGTCCATGCTGACGGCCGGCGGTGTTGCAGGTGTTGCCTC
CTGGGTTGTTTCCTACCCCATGGACGGTACGTTCATCCTCTTGTTTTCAGCAAGTCGGCATTGTGTGTGGTGATTAACGTTGCTGTGTTGCTTTGCTCCG
AGTAGTGATCAAGTCTGCGATCCAGACGCTGCCCGTCAACCACAAGCCAGGCGAGCACAAGATAATGCACCAGGCTCGTGTGCTATATCGTATGGGCGGC
TGGCGAATCTTCTTCAGCGGTCTGGGCACTGCCTGCGTTCGAGCGTTCCCATGCAACGCCGTGACGTTCTACGCCTACGAGAAGACCTCCGAACTGCTCA
AGCAGGCCTCTCGAGACTAAAGCAGCAACGACGTCCTAGAAACCACACGTTACCATCTACATAGATCCCTCTTCAACATAGAACTTCAACTAATCACGTT
TTATCTAGATCTAATTTTCAGGTTGAATCACGTTTGATTCCCGGCGGAATCACAAGTCGATCTTACGTTCCTGCCTCATGTTGGCCTCCCTCTTGCGTCT
GCGCATGGCGTCCCCAAGCGCTGCTGTGGTTCATCGTCGCTTCGCATCCAAGAACAACCGTGAGCACATTGCGGACTGGATGGCGGGGCCGCCGCAGCCG
CTGGACGTGGCCTCCACCAAGTTTGACACACTCTCACTTGCCTTCGCCGACGATGACGCCGCCTCTGGAGTGCTGCACTTGAAGCTGAACCGCCCGAAGG
TCGTGAACGCCATGAACATGCAGATGTGGGTGGAGCTGACCCGAGCCTTTGAGCTCGTGGAGCTGGATCCGAGTGTCAGGGCCGTCGTGGTCTCCGGGGA
AGGCCGCGGCTTCACCAGCGGCATGGACCTGGACGTCTTCGCGCAGATGCAGAAGGTGGCGATGGACGAGTCCTGTGAAGGACGCAAGCGCGAGCGTC