Description :
From Genome Similarity Track
Location :
scaffold_31:65365- 68229
Sequence
2864 bases(100 bases per row)
AGTCAATCATAGTGACTAAACTCAAAAGAGAGTCGACATCCGTGACTAAAGCCAAAAGTAATTGAATCCAGAGTGAACAATTTTTAAGGGTATTCCATAA
AGCGAGGACTCATGCTCTTAAAATCCAAGCTGGAACTTGTAGCGATGTGAGTATAGAGTGTGAAAGTGCGTTAGAACCTTGAAGACACGCTGTAAATGTA
AGTGCATCAGTGTTAGGCACTGTCAAAAGACTTTTAAAACATGAAGACAAGGTACGTCGTAAATTGCTTTTTACGATTATTCCCCAATGTTTGCAAGATA
CAACACCAGGTGAAGTTGAATAGTCAAATATTAAGCCAAAAGTAATTGAATCCAGAGTGAACAATTTGAAAGGGTATTCCATAAAGTGAGGACTCATGCT
CTTAAAACCCAAGCTGGAACTTGTAGCGATGTGAGTTCAGAGTGTGAAAGTGCGTTAGAACCTTGAAGACACGCTGTAAATGTAAGTGCATCAGTGTTAG
GCACTGTCAAAAGACTTTTATAACGTGAAGACAAGGTACGTCGTAAATTGCTTTTTACGATCATTCCCCAATGTTTGCAAGATACAACACCAGGTGAAGT
TGAATAGTCAAATAGAAAAATTAATACCAAAGTTGCGTTGCAGTCATTACAACTTGATGGAAGTTTTCTACCTATAAATTACTGGTCAACACGGCGCAGG
ATTCAACGTGATATTCTTCCCGCCTTGTCAGACTTTCTTTTTCGACTACAACATAATGGCTTGTACTTTGTATATAAATGTGGCTGATACACTCAAGATA
ACAAATGTGCTCATCGTTGTTCTACGCCAGAACCTCCAAAGCATTTACTATGAGAATGCTACACAGCCAACACTATATGGCGTCTCTCATTTCATTGGAT
TTCCGCGACAACTATACAATGAGAACACGCCTCATTCCTCATTTATTTCACTGTTCCCAGTGATCGCCAACAGTTATTGCGGTGGAGAACTTGAGTTGAG
AAGCCGGTGAATTTAACTGCTGTTGGCGTAAATAATGTCTTTGTCGTCAAAAGTCCATATATGGAGTGCAGCAAGCATTCCTTCAGGAGAGCTCGAATAT
ATCATGAATGTGCTGTAGTGACTTGGAACACTTATTTTGTCTCTACTACTCGTGTTATTGAGCACGCAGTGTCGATAGACGAGTCTGATAGTGATTCACG
CAGCATTAAAGGGCCAGGGATTGAGCCAAAATAAACGCAAAATGTAGAGACTCAGAATATACGATGATGAGACATATATTGACATATTTTTCGATGTAGC
ACAGCAAAAATTTTCTCTGATAAGTAAATCGGGGAAAGATATTGTTTCATAATGGTCAGGTCAGCTAAGTGATTACCGTATTATCATTCATAACCTTAGG
CAAAAAGTTTAGTGCGTCATAGTGCAAGCGCTGAAAGCGTGGACAATGAGCCAACCTCATGTGGTTTTTTTTGCACAgagtgctggacaccaatGCAATC
ACTGCCGATATAGAGGGACGTTTACTCAGCGATTAGTTGTTGTAAAGGACTGCAGGGGCATATATAGATAGACTCAGCCCCTACCTTGACCTTGAAGCGC
ACAATCGAAAGCAGTTTGAGCTAGAGTAAACCACTTGGGTAGGGAGTTCAACTTGGCTCTGCAGTGTCGAATAAGTTGACGTATTAAATTGTCTTGAAGG
AGTCGGATACATTATAAAATTTTATGCCCCTAGATCCAATCGAACTGAATGCCATTTGCCGAGAAACAGTTAAGCTGTGTTTTGACGGTGGTCGAGTATT
GTTTACAAATTTCTAATCAAAGACGAAATAATTAATTTCTTCCTTAGAGACTGCTTATACACTCAGAATAAATATTGACTGAATTGTCGTCTTTAATAGT
ATAACGCTGCCCTATAGCGTACGGCTCTCCAACGCCAGACGACGAAAGTCATTGAATACGAAGAAGTGTTTGATTCAACCATCAGCTGGGTCGGCACTGA
GGTTTCACAAGTATACAAAAAAGTGTGGTATGTTTTCATTGTTTAATACTTGGTTTCCACAGTCGCGAAAGGCATTCAGTAAAGTGTGATCAGACGACTT
CCATGGTCGAAAAGAATATAACAGACTTGTTCATATTCAAATGCATTTCAGTTGTAGTGCAAACCTATTGCCCATGGGCGAGAAACTTAGGGGCTTGGTG
TAAGTCATATACCGAATCTGTTATGTCGTCCGTGAAGCTGTGAGTTTGACTATAAGTATCGCAAATCTttattgaaaacattgattgACCACTCTAAGAT
ATCACAACCAAAGCTCGAAAAAAAGAACGAACAGCCCTGGCGAACGTGGATCTCCATGTCAAAAACCCGTTCCCAAGCTGAAGAATTGTGATCGCGAGTC
TTTAATAAAACATGTACTGATGATCTAGTATAAATAGTTGAACCCCAACGACGAAAATTCCCCAGTGTTATAGAACAATATCCAATAACCGCCTGTTGAC
AATGTCAAAACCCTTCGCAAAGTCGAGGAAAATGGCAACGGCAGGAGCTCGCGTCTCACAAGTGCTGGTATAATGTTGAAGATACAAGAAATACCTTAAT
GCGTGGCGGGCATCACGACCGGATACAAACCTAAATTAgtcattgccgagaagctTAGGTAATACTTGGTCGGGCTCGTAAGCCAGAGTTTTGGCCCAAA
TCTGGTGTCGTTATCTAGTAGCGCGAGGGGCAATAGTTCTTTGGATATGATCAACTATCTTTCTTATAAAGAAGAGAAGGGTGCTCTACACGGAAGAAAG
CGTCAGCGACGTCAAATTTCACTTTTGAATAGGGCCATTGCTGTGTGATACAACATTTGATTCG