Description :
From Genome Similarity Track
Location :
contig_15:653603- 657993
Transcript NameFunction/comments
g3486.t1hypothetical protein PHYSODRAFT_284526
g3487.t1hypothetical protein PHMEG_00013327
g3488.t1hypothetical protein PHYSODRAFT_344112

Sequence
4390 bases(100 bases per row)
AGTCGCCCATGGCTGTCAAAGTGAAGAAGGTCAGGACCAAGAGGCCCAAGGAGGTGATGCTGGGCATCTGTGGTGGCGTAGGACCCGCCGCCGGGCTGCT
ACTGCATCAGCTCATACTGCAGAACACCGACAGCGCTGGAGAAGACCAAGGCCACTTGAACGTCTGCCACTTCTCGCGCTCCGAAGATATGACGGACCGC
ACCGAGTACCTGGTTTACGCTGCGAGCTCCAGCGCTGAAGCGACCGATTCAGACTCGGATAGCGGGTCGTCTCCTGGAGAAGTACCTTGTGACAGCAAAG
AGTTGGCCAAGGAGGTCGGGAACCCGGCGTGCGGCATGGCCCGCACGTTCGCCATGATGCACGCTGCAGCTACGGCAGGACGTGCGCGGCTCGTGGTGGG
CGTGCCCTGCAACACATTTCACGCTCAACCAATCTGGGACGAATTCATTCGACGCACGGCTCACGCTTGCAATGTGCACCATGTGCATATGCTGGAGGAG
ACAGTGGCGTGCATTGCAAGAGAGTTGCCACTGTGTAAACGCATTGGTTTAATGTCTACGACGGGTACTCGCGAGTCGCGTGTATATCACGACCTGCTCG
AGCCTCGCGGTTATAAGGTTGTCGAGGTGTCTGCGGGAGCGATGCAGCAAGAGCTGCATGAATCGATATATAACCGCGAATGGGGAGTGAAGAGTACAGC
GCCGGCCGTGTCACCTCGTTCCGAGGCCAATTTCCAGCGCTACGCTAAGCTTGTGCGTGAACACGGGGCTGAGGCTATCATCCTGGGTTGCACCGAGATC
CCGTTCGTATTTGCTGGCAAGACACATTTCGCTGGCGTTCTCCTCATAGACCCGATGGTGGCGCTTGCCCGCGCCATGATTCGCGAGGCCGACCCATCGC
GGCTGAAAGCTCGAGGCACCAGCAACACAGCCAAGGTGTCGAGTGTGTATTCTGTCGTGCCTCTGTGTGCACCCATGGCATGCACGGGTCCATTAGCACC
GCTCAAGTATGTTGGCAGTTCAAGGTCTTCAACGGCAGCGCCATCATCAGGGTAACCTCATGCTACGTAAATGATGCTTGTAGACCTGAAGGTATTAGAT
CGTAGTACGAATCAATCGGAGCTCCAACATTATTTACTTGCAACTAGATCAATGATGAAAGCTGGTTAAGGAAGTCTGTCGCCTTCTTAGACGCTGCGGA
GTCCACAGCAGCATCCGTACTTTCGTTCTTTACCCCGCCATCACCACTCGCCGCTGCTCCATCTCGCTGTTTGCGAAGACGCTCCAAGCGCTGCTGCTTC
CTCGACTTCTTATCAATTGCACCTGCAGAGGCAGCGGGCGCCAGTGACCGCGCAAGTGTCGCTCGCTCATGAACCTCCGTCAGATGCTTCTTCTCCGCGG
TTTTCAGCCGCTTCTCCCACTGCGAGATGACAAAGCTGCCCCCACCAGCCTTATCCTCTTGGTCTCTGACCTCCTCCCTCTTTACTTCATCGTTCTGCTG
TTGAGTCTGCACAAAGGCCGCGTACTCCTCGCTGTCCGGTGCAACTTGTCTCGAGCGTCCGAACTCGTCCGTAATCTCCACACTCGTCGCCTTCCTGCTT
CTGTCCTGAGTCATGAACTTCTTTGCTTCAAAGTCCACGAGACACTCTCCCTTCAGACTGTCGTTGCCACCTCCATTGACCATTTCCTCGTACAATTTTG
CCTTCTTGCGCAGCATCACGCCGACTTTCGACTCCACGCTTCGTCGTCGTCTTCATCCGGCGCTTCCTGCTGCTTGACCTCTTCGTCGCGGCGTCTGCGG
ACCTCCACCCCGCGGTTACGGTGCCTTTTGTCCTCGTCCGAGCTCTTGCGACGCTTGTTGCCGCCTCGCAGATGCGCATATTTGCCCAGTCGCGAGCTGC
CGTCGTCGTTCTCGGCCGTCAGAGCCTCTTGCAGCCGACGCTTCCGCTCTTGGTCCTTCTGGGAGACCAGGGCCTTGAGGTCCACGAGACTCTTGGCGTC
CACATTGATGGTCTTGCCCTTGGACGGCACGAGCGCCGATCGGTAAGAAACCCGAGCGACATGCTGCGCTTTTTGTGATTTGTGCTGTTTTTAGGATGCT
AACGTTATTTTGATTGTAGAATAGTCCGGTTTTGAGCACTTCAACTTGGGTGGTTTCCTGTTTCTTGTGGTATTTCTGTTGGTGTCTTGACGAGTGAGTT
TAATTGGATTGGGCGTGCTGCTATCGACAGGCGGCTTGCATCTACCGAGCAGGACTCTTGCTGCGGGGGGAATTTGCAGCCGTCATGTTCCGCAGGTCGG
TCAACTCACATATTGTGCCAGTGATCACAGATCCCGACGCTGCTGCTACGAGCTTAGAAGCGGGGGCTGCAATGGAAGAAACGCGGTCGATACCGCCTGC
ACAGCAAGAACCAGCCACGGGCCCGAGTAGCCCAACATTTCTCGGCCGGAATAGCAGACACGAAAGCAAGACAGCTACTCAAGCAATTCCAGGTGCACCC
GGCACACTACGACGAAGCAATGCCTGGGCTCGCTCGTCTGGAAGTTTGCGGAGACTCGCGACGGAGAAGTCCAGCATAAATGTACTGCGAATGTCGCTGC
TCGATCTCCACGAGCGAATGCGTTATCGTTGGGTGCTGCATCCGCAATCTCCACTCAAGACCAGTTGGGACCTCGTCAGTGCGTTAGTCGTTGTTTACTA
CTCCTGGATTATCCCATTTATGCTGTGTTTCGACTGGTACGAGCCATCGCAGGGCACCTACATATTCATGAAAGTGTTGGATGTGTGGGGGTTCCTGGAT
ATCGCGTTACGATTTCGGACGGGGATTATCGAGTACGGCGCCGTGGTGATGAATCCGCGCTCCATACGACGAGCCTACATACGCTCTGTATGGTTCCCCA
TTGATATTGCCTCCTCCATTCCGTTCGAGTACTTTCTTAAAGACAGCGCGGCCAGTATGTCAACGAGGAAATCGTTCAAGATGATCAAGTACATCAAGCT
GCCACGCTTGCTGCGTCTAGGCCGTTTCGTCAAGTATCTTCGGCGGTACAAACGCTACTCGAGCGTCATTATCACACTCAACGCGGTCATTTTCTCCGCC
CACGTGGCTGGTTGCCTGTGGGTCGCCATTCTCAAGCCTTGCGCTGACGCAGTCGAAGCCACCCGACCGCACTGCAACGGTGGAGGAGAGATGGACGTTT
ACTGGGTCGCCTTCCACCACGGCATTGTGTCCATGTTGGGCGTATCCGCTACACATGTAGAAGCCCGCGACCGCTTTCTCAGTGGGGGTACAATCATTCA
CCCAGTGACGACTTGAACAGTGCTATCTATCTGTGGTCCAGTGGAGTATCCGTGTACGGCGTCATTTTGACCTCCATAGTGTTTGGCACCATTATCAACC
TCGTCCAAAGGTATTTGAAACAGTTTGTCCTGTGAAAGTCCAGGCAACTAACAATTGTTTGTGGAACGATAGCTGGAACAGGGCTGAGAACGCGTTTCGT
AAGAAAATGGACCATGTCACTCACGAGATGGACGCGTTGAGCTTACCCAAGTCGTTGCGGGTCCGTAATATTCTTGTTGTACCTCATACAAGCCGCTAAC
TTGGTTCACTGACCGACGGTTGTTTGGGTTTGCTGCAGGCACGGGTGACAGCTTACTATGACTACCTCTGGCTCAACGTACGTTCATCTTGCGACCACGC
CTCCCCCGATCGTTTACTGACCTTTGCTGCTGCAATTGCAATCCATCCGCAGAATCGTGCTCTGTCGGAGCAATTGAATTTGCTGCACGACCCGGGCATG
TCGTTGACGCTGCGCCGCCAAGTAGCCATCTACCTTTTCAAAGACAACCTGCAGAAGATTCCGTTCTTCCAGCTAGCCACGGACGCGGTATTGGGCATGA
TCTGCATGCAGCTTCACCAAGTTATCTACATGCCGGACGACTACATCATCACCGAAGGAGAAATCGGCAAGGAGCTGTTCATGATTGTGAAAGGTATCGT
GCGCGTGCTTCCACCAAAAGGCTGCAAGAAGCCCGAGACCGAAACGATCATTCTGCTCAGCGAGGGCGATTTCTTTGGCGAGATCGGAGTGGTCATGGAG
GTCGAGCGCACACGAAGTGTGAAGGCAGAGTGCATGGCTGAGCTATGCGTTCTCGCCCGGGAAGGCTTTGACAAAATCTTGGTCGAGTTCCCCGAGTTCG
CGACCGCCATGAAGAAGCTCATCGTGAAGCGCGTGGGCGAAATGTGGAAGGACGACGGCCCCGAGCGCATGGAAAAGATGACGGCGCTCGCCGACGCCAA
GATGAAGAAGACCATTCAGGCCTACAAGAACATGGACAAGCTGCGGAACAAAACGCGAGTCCTTGCAAACTTCCGTCCGCGGTTGTCGAA