Description :
From Genome Similarity Track
Location :
Scaffold_114:65350- 70696
Sequence
5346 bases(100 bases per row)
TTCATCCGGCAAGGCCAAGAGACTTTGTGTATTGGCCGATTATTATCGGGAGGTTTTACGTGACGGCTTATTGTTGCCTATTTGCACGACTGGGAGTGCT
TTAATTGCCTCCCTTTTATTCTTCCAACCGAGTGTTGAACACTCGGTGATCTCGTAAAAGGCTTACCCGTGCCTGGTACCCTTTCGCTGTTGGGACCACG
AGGATTCAAAACACCTGCTAGCTTTGCTCGTGCTAGTAGCGTGTTCTTATTTTTACTGGTTGGCCTATATAAGTAGTTTACAAGGTCCAGTTTGTCCCGG
CGCAAGGGCAGAACTGGGGTCTTCAGGTCCGCCCGAACGATCGTTACTATCCTAGTAGACGTATTGTTGTGGTAACATCCTAACTACGTTTGTAGCTAGA
GTTCACGTGGGATTTCCAACACCACAGTAGTGACGCCGTCGAGTCCCTTGCACCTTGGAGTCACCGTACATCACATGACCGAGGGTTCGTCGCTTGAACA
TCTTGGGGAGTTCGCGAAAGACTCAGCGACCCTTTGAGCACGTTCACCGTCTGGGACAGGGCGCGAACCGTTAAAGATACTTATGCGACGGTGCAGACGA
CGCTTGGCGTGCAAGAAGATCCATAACGGATCTTTGTTCACTTGATATTTGTATACTTGATTAGGACTTCTTATTAGGAATAGACCCGAACGGGTAAACA
TAAATACAGAACAGAATTTCCATTCAAGCACATAGAGCGACGTCCGACTTCAATGTAAGCGCCTGGTCAAGCTTTTTTTGAGTGTGTTATGCCTGTCGGT
GAACCCGAAGCTCTGTAGCGAGGGTTCATCCGGCAAGGCCAAGAGACTTTGTGTATTTTGGCCGATTACTATCGGGAGGTTTTACGTGACGGCTTATTTG
TTGCCTATTTGCACGACTAGGGTGCTTGTATTGTATCACTTTTATTCTTCCAACTAAGTATCGAACACTCGGTGATCTCGTAAAAGGCTTACCCGTGCCT
GGTACCCTTCCGCTGTTGGGACCTCGAGGATTCATAACACCTGCTAGCTTTGCTCGTGCTAGTAGCGTGTTCTTATTTTTACTGGTTGGCCTATATAAGT
AGTTTACAAGGTCCAGTTTGTCCCGGTGCAAGGGCAGAACTGGGGTCTTCAGGTCCGCCCGAACGATCGTTTACTATCCTAGTAGACGTATTGTTGTGGG
AACATCCTAACTACGTTTGTAGCTAGAGTTCACGTGGAATTTCCAACACCACAACTGGTGCCGCGACCCGGGAACAGATTGTGACCATTGTGAACTGTTT
GTATGGCCTCCCAGTTTACGAGCAACCAAGAGAAGAAGAACAAGAAAAAGACAAGAAACATGGCGAAAGGACAACCGACGGTACCAGTTACGCCTGCCAA
GTCTGGCGGGGCTCGCAACAAGAGTTCAAGCCCGGCTGCGCGCTTTGCAGCCGCACCGAGCTTTCAGTGAGCTTCGACGACGAAGCGGACAGCGGACCTG
ACGCCCACGATTATGAAGATTACGAAGACAAGACGCCGGCCCCAGAGCCAGGCGCAACGACGCCGGAGACGGCCACGCTATCATCGGGGCTGAGCGGGGC
GACCAGGTCCCTTTCGAGGAACCTCGCCGACGAGCTCGATGATGTTGCGGGACCAGAACCGGCCTACGATGATTATGACGATGGGACCGAGGGTTCTAAG
CCTTCGGTGGCGAGTGCGAAGCATTCAGCACTGCTGAAGGCACCTCGCCCACCTATCAACGGTGATACACCAGCCGCCAAGCGCGTTTTCGACCGCGTAC
AAGCGCTGATGCAGAATGATGAGTGGATGCAGCTGTTCAAGCCCATCTCCAAGAAAAAAGCCGACTGGCCTGCGCTTGCGCAGGAACTTCAATACCCAGT
CAACTCGGGTTCGACTAGCCAAGTTGCCGAGGATTCAGTTTCGCTACTGTTGTCGCTGGGCTTCGAGAACGAGACGTACCCATCAACGATGTCGCTCCAA
GATTGGAGTCCACATGAAGCCGGAGCTGCTCTCCAGAAATGGAAGAAGAAGCTTCGGAAGGCGTTTGGCGCTGTTGGCATTAACGCTGGAAAGCAGCCGG
TGAGTCGACCGCTGATTCAAGATGAAGATCCGTCCAAGATTCCACTGCCACCGACGCCCCAACGACTCATTCGTACTCCTCCGACCAAGCGTGGAGCTGA
GCGTGGTGCCTTTGGCACTACCGAAGCTTCACCGTATTTTCAAGACTCGCACATGGTTACGCCACGTTCGGAGAGCCGTATGCAACGTATTTACGCAAGC
AACGAGGGTTCGTTCGGTCGCCGAGGCGGTGCGCGAGCTCCCAAAGGTGGTGCCGGACGTCGTCAAGTCGACAGCGATGGTTCGCCCAGTGACGATGACA
TTTTGGTGCGTACATTCGACGAGGAAGATCCTCAACTCGAGTTGATGCGTCAGATGAATGAGCTGGCGACGCTGAACGACGTAGACCCGACACCGAGGAT
TGAAATGGCTTCGCACCGACCGCTGGATCGCATCACGCCGTTTTCAGGCTCTCGCAACAAAAGCGAGAGCTGTATGCAGTGGCTCCGTGGGTTCGTCTAT
GAAATGACTGGAACCCACACAGATGCCGATAAATAGTGCATTCCATTTGAGCTAAGTCTCCGGGACGGAGCCATTCATTGGTTCCGTCAACTTCCAAAGA
AGACGAAGCGCAAGTGGAAGCTGCCGAGCGATGCGTTCATCCGCTACTACTGCTCGCAGTTCACTCAGACGGCACTGTCGCGTTACTACTCCGCCAAGCG
GGAACGTAATGAACATCTGCGCGACTACATAAACAGGCTGAATGGTTACGCTCGGACCGCCCGTCTACACTTTGAGAAGAGTGGTCGCGACGCGAAAGAA
CACGTACAGCAGTTCCTGGCAACATGCGATGATGACAAGCTTGCGGAGAGTCTTAACCACGCTCGAGTCGCCGACATTCACGAGCTCGAAGAGATCATCG
AAGATGTTCTCAAGGGCAAGGAGAGAGTGGCGTAGCGTGACAGTGAGTACCGATACTCCAAGAGTCGTGATACGCGACGCGACGATGGGTACGCCCGCAA
CAACCGGCGTGATGACCGTCGCCGCGATGACAACCGAAACAAACCGAGAGTGACGCTCATTGAAGCGACCTACTAGCTGAATTAGAAGGTCGTGAAGCTG
CTCAGGGAGGCAGCGAGTATTCAAACGAAGGTCCGAACGCTTACGACGATGTCCAAGATGAGTACAACGACTTTCAGCCCGATAATACGAACGGTGATTT
CTCATTGGATGAAAATGACCGATACCTCGCCGCTGCTAACGAAAATGAGCGCCGTGCAGCTGCTGAAGGCACCTACGCACGTTCAGACAACCGTCAACCG
CGTGGAAACGCGCCTGATCGTGAGAATGGCTTCAATCAAGATCGCCGAAGCGGTGACCGTGGGATCAATCAGGACCAACGCGGTCGACGTGACTTCAACC
GCGACAACCGACGCCCACAGTACGGACCATGCGCGGTGTGCGGTGGCATGAGTCACTCCGCCCACTACTGTAACAAGCGATGCAAGTTCTGCAAACAACT
CCACGATGCTGGACAATGCGAACTTTTCCGCAACTTCCAAGACCTTGCCAAATTCGTGCGAGCTAAAGGCACGAAGGAGGAACTCCCGCCAGAGCTCAAG
GCCGTCGTTCAAGAACGTCATTTAAACTAGGCAGCCCGCCAACTACAACTGGGTTGGTCCCTATCGGGCTGCCACAGTTAACCGAGCCTTCAATGGAAGC
AGAGTGCATCTTTGCTTTCATGGGGCAGAGTGAATGGCCTGATAATTACGTAACAAGTGTGAACGCGACGGAAAATGAAAAGGAGAGGAGTAGAATCCTC
GGTGGAGGTGTTGGAGAGAGTGTGGAGTGTGCTGATGCTGATGAGGGTACCAGCGAGGGTTCGCTCGGCTTGGTTTCGAGTGCAGCGCGAGACGAGCCCA
AGGGCCACTCCAAGATGATGAAGTTGAACCCTGGCGAGAGACAGGGGTGGTGGTCGGCCAAGAAATTCGACCGACGGATCAGAATGAGAGCTCTGGTGCA
AGGCGCTGTGAATGACCAGCGAACGAGGATCCTCCTCGACGCAGGAGCGAACGTTAGTGTGATCACTGACGCCTTTGCCAAGAAGTTGCGACTCCGAGAT
GTACCCGATCACGGACGCCGCATTGACATTCAAGGTATTAACGAAGGCAAGGTGTCTACGACGCGACGAGCGTGCGTCAAAATTACGCTCGGATGGGAGA
TGGTGTACGAGTTTGAGATGTGGGTAATGGCGCATAGTGCAGGCGTCGACGTGGTACTCGGGACCGACTTTATGATCCCAGCTGGGATCCGGTTGGACCT
GTTTCACAGCGCGGCGCAATTACCGCACGAAGTTCAAATCCCGCTGATTAAGACCAAGAACATGATCGACAGCGAAGAGTACGGCTCCCATGTTAACGCC
GGGCCACCCGAGCGTTTGGACATTCAAGCGCACGAGTGGCGAGAATATCGACTAGCGAAGCGCCAAGTCGGGCTGGAGGAACACGTACTGTGGGTTCGTC
GAACGAACAAGTTAATCATCAGTGACGAGGTTTCGACGTGGACGGCCTCAGAGCATTCGATTGACCAACGTGTCTGATCGAACTGTGTACCTACCAGCCC
ACGACTCGATCGCGATGTGGATTCCAGATGGGGATTTGCCACGAGGTGACGGCTACGTGCGTCTGGAGTCAAAGAAGTACCAAGTCGGGCAAGTGTTGGC
CTACGAAGATTGCAGAGACCGCGAGCTCTTCCAGCGTGAATGCGAAATCTACGAACAATGGCTTGCAACTCAACCTTCGGCAGTTGATCGACCAGACTAC
CCAGAACCCAGTGGGGTACTGGCACGGCCTCTAGAAGACTCGCTAGTGGATTCTAGTGATCGTCTGACGTGTGCAGAACGTTGGGCACTGATCCTGGAGA
AACGTGAACGAGTGGAAGCCTGTCTGGCGTCTGGGGTGACAGCCGGGGACTCGGCAGACGGTCAGCCTCCCGAAGCGCCTTTGGACACTTACACGACAGC
TTACGGCGGAGACAATATTGTAAACGAAGCCTCGGTAGCGCGTACACACGAACTACTGAGCCCGGTAGACGTAATACATACGCCAACGAGTGTTCGTGTC
AAGTCTGGGGTGACCACGGAAGCAACAAGTAACAGCACTGAATTAAATGGAGTCACCAGTTTTGACGAAGCTGTCCCGGCCTTGTGTGCCACCAAATCTG
CGAACGAGACATCGGTGGTTGATCCAGTGGATGCAGGCATCGCGCT