Description :
From Genome Similarity Track
Location :
Scaffold_352:6533- 10835
Sequence
4302 bases(100 bases per row)
CTCGCGTCGAGGCCGCGGCAGATGGACTTGCAAGCCGCTAGCCGACGCACCAGGATTCGCCGACGCGCTGGAACTCATCGCACGAAATGTGCGCTGACGC
AGCTGGCAAGCGGATCGTTCTAGACAGCATTATGGAGCAGTTTAAGGACGAACTTGGTCGCGGCGCTCTCGCTGATGCAGAATGGCAGGCCATTAATGGC
GTGTCGACGTTCCTACGCGGTCCGCGCCAAGTCATGGAGCGCCTCTCGGCAGATCGCAAGCCGACTATCGACCTGATGACGACTTCTATCTCTCTGCTCG
TCAAGCACTGCAAAAACAGCGAAGAAACGTTGCTTGAGATTCAGGGGAACTTGACGACGGTCGACATGAAGGATAATCTCAACCAGTACAAGAGAAAGCT
GGTGCAAGAACCGGCAATTATCGCAGCGTTCCTGATCCCTCAATTCCCAAAGCCGACAGACCTGGCGAAGCACAAGCGCGTGGTAGATCTTGTTCGCAGC
ATGCTGCAACGTCGCTATTCCGCCAACCTCAACTTGAGCCTGATAATTGAGACGGAATCCAGCAGTAGCTCGCTGTTCGCATCGATGTTTCAGCCTGTTT
GCTATGATGGTTCCACGGGCGACGAGAACGAAAAATATTTGTCAATCGGCGCCTTCAAGTCTTCTGGCTTCATCGACGTGCTGTCGTGGTGGTCGGCCCG
GAAAGACTTGCTACCCGTCCTTTACCATATGGCGGTGGTCTAATGTAGGACGCCGGCGACATCGACACCATCTAAGCACGTCAACAACGCCGCCGGGCGC
AAATTCACGTGCACTCGACAGCCACTGTGGTCGTCTGTGTTTATCATGACCTTGTGCATGCGCTCATGGATTGGTGCCGGCATCTTCAAAGTGCCGGCGA
ATCGAGCGCGAGCAGCGGCCAGGCTCGTACAGTCCGGCGCCAATGACGTGTAGTCCGTCGTCCAGCAGCTCGAGATACAACAGAAACAATTTGAGACGAG
GAGATCCTTGACGATGGGGTTGTACAGTTACTGCACAACCGATTCGCTGATATGGTATCTGAGGCGGAATGTGAGCTCTGATAAAATACCGCTAAAGCGT
ATTACGATCGCTTTACCACCTAGCCTATACAACTTGATCCTACACCACTGCATTCACCCAACCTATTTTGATAGGCCGACGACGTCGTCATATCATCGAT
ACAGCTGCAACTCCACGGATTTCATCAATCACTCAAGTGCTTGTTTACCGTGTAATTACCCAGGTAAAAGGGTAGAGTAAGGTAAATGCAAAGGTAGCCA
CAGACCAACAGGGTAAAGGTAGTGGTAAGGTAAAGGTAGAACAAAAACTATTGCCCGTTAACCTTTTACCTTACCTTACCGAGCCCTAGTGGTCAGAACT
AGCAAATCTGTTCTGTCTGTATTAGCATCTCTTTATTAGGGGTGTAGTCGTGGGTATTGTGGTCGAAGTAGCAAATACGCGTGGTAAATTCGGCAACTTC
TAGCATTCAAAATAAAAATATATCAATTAAAACGTTTATAGTCCACTTCTAATCGATCTTCCTTCAATCATACTGTTGTAGGACTCGGCTGCTGATCAGC
GTATGTCTACGAAATAACCATATGGGTGAGCTCTTACACCACGAGTAGCCAACCAATGTAAGACCGATCCCCTATCACGCAGCTTGAGAGTTATACCTAA
ATGGTGTAAAAATGACCACGACTTGTGCTTTATAAACTACTGCTTCTATTCAGTATGTCTACTAGCAACTGCAGAGACAATGCTGCCAATGTGAAAGCAC
ACCAATGAACATTTGATGCAGTCCGCAAAGTAGTGCTTCAATTCAACAGAATGTTGATGTAAATGGAAGTCACATTGGCCGATACTAGCACGACATAGAG
CACCAGAGAAGTCTGGAAAGTCACACAACATAGCCAGTGTGTAACTCTGTTTATGTCTTATACTTCTGCTTGTACTTTGGAAAAAGCACACAGCATAATT
ACAGCATGATCAGCTCTCTCTTTCAATATTCAGTGGTGCTGCAGGAAGTGTCAGCCACTATAACTTGATCCTATCACACATCAAGATCTGATATTTGACA
AGGACACACGCTATAGATAAAGATCCACAGATTTGCGGATGTGTGCAATACGAAGAGTAGCACTAAATGATGCTCATGAGTTGCAATCAAACGTCGAGCT
AGCGTCATTGGCCGTGCTCTGAGCCTCGACTGGGGTCAGACTCTTGCCACTCTGCATGTAGCGGAGCTACCCTTACTCCTTTTTCAGATGAAGACTTGTA
GACTCGTAGAGTCTCTCTTAGTATATAAAAATAAACGGGTATTACCTTAAAGGGTGCCAAGTCTTACAGACTTAGTGAGACTTAACTCTGAGTGTATGTA
CAAGCTCTTAAGCTTCTAGTCTTGGTTCAGGGGACTACGGCTCCAAGGAATCACGTGGCACTAATGCTCAATAGTACTTAGCCTTAACTCAGGCACTGAC
TCTTGTAACCAAAGACGTCTTGGAAAGACACGTGTCTGAAACTGATCGAAAGGGGAACTGAATATATTTACTGATTTATAGCGATAATAAACCTTACTTC
CGTCTTTAACCTTGAAACTGTGCTGCCTACTCGAAAAGTCCTCATCGTAGTTCTTCTTGTGTACCACACCAGAACTACGTCGCCTCTATGAAGACCGTAT
TACGATAGATTTCCTCAAACCATAACCGATAGGGTACGGTATTATCGCTTAGCGTATGTGATACAAAAGTACGCCATATCAGTGATACTGATCTCGTTAT
GTGTGTATCACACCCGCGTACCTGGTTATCACAACCATTTGTATAACCCCTTTACACCCTCCCCCCACCAATCTGTCGATACACCGAATTGACATTCTTC
ACCTCTCTCATTGAGAAAGCTCGGAGAGAACAGATAACCTCACGGTTGTGTTCACGACACCTTGCGCATCAATGGCGAAATTATCGTATTCCTCCGAGTC
TTTGGAAGATATCATACGAGACGAGAACATCGTCGATTATGACAGTGATACTGTCGTTTAAGGGATTGAAACCCCCGAACCTGCCACGTCAGCGTCGCGC
TAACCTTCGCGCATTGCGCCAAACCAGAACGATGCACGGCTCAAGCGCTGACTGCGTTGCGTGCTTCAACCACTCTTGATGAACCTATCATCACCAACAA
GCTCGATTAGCAACAGCAACGCTATATCGAGAATAATGAGAGAGCTAGACGTCTATCTCAGACATTATCTATTGTCGAAGCGCATTCGGACTATCGCTTC
AAGCCCTTAAGCGTTGATAAGTTGGTGTGAAAGTTCGCAGGGCAGCCCTTGAATACTTGGCCCACAGGGCGTGAGGCTACGATGTCTGACGACATTTCCG
AACGAGATTCTATCAGAGAGAGATACTTGACGCCCAAAACGACGACGATCTACGATTATCAAATCAAATTGACGGAACAAGCACGTGGTGCCTCTGTACC
GACGCAAAGAACGGCCCCGGTCGTTCTGTACCCAGGTGAGAGCGAGGCCAATGACGACAGCACGTTTACTCGTTGGGCAAATAGGGCACGTTGGTTGCCC
GACATGAGTGCCCTTCGATATAGTGCCTCCAAGGCTGACGTTCGGGTATAGCGTAAGATGCGCTATGAGTTTGCTAATCTAAAGGCCAAATACCAGCTAC
GTTCGCTGTATCTCACACAGTACGCAAAACCAGTTGCTATCAAAACCACCACTGTTTCGACTGTGCAGACAGTCGCGGGTCACTCGGTGTTAGTGATCGA
GCCCTACACCCCACACCTATTGGTGGGAAGCGCGTTGGGGTGCAAGCTGACCCGCAGCGCGACGCTCTAAAACATCAACGGCATACGGGAAATCTTGCCG
AAGGGTACCTGAAACTCCCATGAGTTTTCAGACTCAAGGTATCCGCACCACTTCACCAGACACTGGTATTGATCTTTGTGACGACGCCGCTTCAGAAGTC
TCTCCACATGGAACTGTAAGTTCCCTTGCTCGTCGATCAACGCAGGAGGGGGTTGATGTGTCGGCACAGGCTCACGAAGACTTGGTGTCAGAGGTGAAGC
GACTCCGAGAGTCTTTTGCGCACGTGCAGACGGCACTGGATCATTCTGTAACAGAGAGTAAACAACTCCGGGAGATCTTCGACCAAGTGCAACGCGCTTG
TGAACAGTCATCGACTGAGTTGGCTCATTTGCGTGAGCACCGTCTCGGTTCGATCGACTCGGTCGACAAGCGACTGCGGAAAATGGAGTACAACCTGCCA
CA