Description :
From Genome Similarity Track
Location :
Scaffold_224:6532- 9864
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_224-fgenesh-gene-0.1Transmembrane protein 70
Pytap_DAOMBR444maker-pag1_scaffold_224-fgenesh-gene-0.11GF21016

Sequence
3332 bases(100 bases per row)
ATGTGGAGCCGAGGGCGGACCTGACGCAAGTGCCTCTTTGCACACACAGACCACCGTTCTGTTTCGCCGGCCTGTTGACTCAATACACAAGATTAAAATG
CGATGGTCCCGCAAGCACCCCACTGGGTCTTCTTCGAGTTTGCACGTGTCGTCTAATACTGGGCgCgTGCAtCCTACAGCCTCGCCCCACGACTGACTAA
ACCCGGCCAAAGATGATCAGACATATCGGtGAGTTGTGCGATTCGAATCCATTTCGAGTTCCACGATGATAaCGTAAAAaGCGGTATTTTTCCATCGTCT
TTGCGGGGATTCGAATCTACTCGTCTAGGTTAAAGCATCCTGACCAGAGACACTCGCCTCATTAGTAGTGATCACCATGGTCCACACCATGCTGCGTCTG
TGCGTCGCCTCCGTGCGCCCACGCCTCCTCACGCGCCTCGCcAAGACGCATGCGCTCACTCTGACGCATGGGTCGCGGGCGTCCGTTAGTCCATTCGCGC
agCATCGCGGCTTCTCCTCAGTGTCTGCTGATGAAGATGAGAAGGAGCTCGTGTACAAGGCGCCGATGGCACGCGCTGTCCGTCTCATGAAGGGAGTCTC
TGTGACATCGTGCTTCCTCACTTCGGTTGGTATGCCAGTGCTTTGCTACGTTAGCGAGCAATCCGCGTCTGTTATCGGCAAATGGGCCATGTGTGGAACG
ATCATGGTGCGTCTCTCAGTGCTTCTGCAGGCTGACGCCATCCGCCACTCACGCTTTGTCTCCTCCTTCCTCTAGCTCTTTGGTCTTGGTACGACGTCGC
TCTACCACGTGCTTTTCGAGCCGTATATCCTTCGCATGTGGCTCGACAAGAAGAATGCGGACGGCGACGCGCGCGTTACTGTCGAGACCGTGACGCTGTT
GGCGCAGCTCACGACCCGTCAGTTCCAGCTCAGTGATGTGACCCGTCCACAGAGTTCGATGCACCCCATGGTCTcTTtCCGTGCTAAGGACAAGAACTAC
TTCATCCACCCAGAGGAGATCCAGGACGAGCAGCTCGTGAAGAAGCTCATGGGTGACGACTTCAAGATCATCAAGAAAGAAGCCGCGCAGGAGGAGTAAG
GATAGCTGGTCGCTCACCACAATAGACGCCACGTGTATCATCAATCTCTCTCGACCGCCTCGATGTAGTCGTAGCTATTGAGCGCGTCTTCGCTGTCCAC
TGGGAGGTCGTTCTCGAGCGCATCGAGCGCTTTCAAAGTCGGCTTTGGCaCGGCGTCTTCGCTCTCCGAAaGAACAGACACAGATGCAATAGACTCagAC
ATTTCACTAGCAGCACGACGTCAGTACTATCATAGAGGAAGCCATGGGTATCGCACTCACCTGGCAAATTCCTCGTCGTCGGCTTCTTCCTCCTCCTCGA
CCTCTTCTTCGAAaTCGCTACCATAGTTATCGTCTTCGTAGTCTTCGTTGTCGCCTTCGcTTTTGCCAGCTTTTGAACTCGGGCTCAGCTGATCACGTTC
AGCGGCGCGCTCATCCCGTTCGTCGAGCGCCGTCGCCTTGAGCTGATGTAGGACTCCTGTGTCGTCTTCAGCCTCCATCTGTTTCAACTTTTCTtCCAAG
GCGCGCAgTCGAGCTGCCGCTGCGTCTTCGTCCAAGTCTTCTTCGTCCTCCGCCTCTTCTTCTTCgTCTTCTTCGAGCACGGATTCGTCCTCTTCCGATT
CGATTCCGATCTCTCCATCCTCATTATTCTCTGACTGTGGTGTCCTCGTCAGTCCACTGCGTCCCGGAAgTGGCGGTAATGCACcAAGTTtCGTTGGTAC
TGGAGGTGGACTTGCAATttCTGGCGGCTCATGAGCGACTTCTTCTTGATCATCAGCAGCTAGCGTGTCACTCTTTCCTtCATCATCACTCTCATGCTCC
TCGTCATGAttcACAAACCGACCAGATGCGCCTTTGCCATGCTGAGTATCGAAACTCGCTGATTGGCTTtCCACTACCGACTCTtCTTCAAaCGAaCCGC
TCGCAATCTCTTCGGCCATACTCGCTTCCATGTCTTCCTCTTGCTCCCCTGtGTCCACTCGTTCGGGCTCACGTGGAGGCTCCGGTGCAGCTCGTATCGG
AAGACTGGGTgCCTCACCTTTGGTGCTAGTCGGTAAGCAACTCTCTCGGTGGACGTGTTGCTTTTGAAGAGGAtGCTCTATCTCTAcGGgCGTCGTCTTC
ACTGTCTCACGCGCAAGTGAGCTAGTAGCAGTCGTCCAAATTTCGTGTTGGCCCACTGGCTCGCGTACTCGGCGctGCACCATCTTGACGAGCACAGGCA
TCTGTTCATCACcGGCATTCACCCCCACATACTCGCACAAGAGTGATCGACTGCGCCACTGGGACATCTTCTCCACCTCACTCTCCACGTTCGCCTCAGC
TAGAAACACTGCCAGtgTGTGGTCCAGCTGCAGACACTCGAGCATGTTGCGCACAAGCTCCAGCGCTACTTGTGCATCATCTCCAcACGCTTGTACGAGG
GTGTTGCAGGGTGACAGAgaGGACTGCGACGGCCGAGGAGACAGCGTGCGGTCACTCGTCCGCCCATGGAGCGCCTGGAACACAGCGgCGCGCAGTTGCG
CCTTGATCTGGCCCAGTACGCCCTGGCTCTCGAGTGCCTTGGTCACCTGCTCCTGCAaCGCCACCTCCTCTGCCGTTGTCTGCATGGAGGAGCCGACCGC
CATCGTGCAGTGTTCCGTTACCAGTGTcTGTCGCTTCATGCGCGACGAGATCAGAGCATTTCtaTATCTGAGTCTGATACCATGAGtgtggaaaTcgCcA
TGACACGCCACCAAGACAGGATGATTCTTTCGTGTTCTTATActGTATCACTCACTGCCCTCATGCCTCACAAGATGCAACGCATTGAGAGTATCGAAAG
gTGCTGTCGTTCGTGAATTGAATCAGAtGTAACGAGTATGTCATGACGACGCAGTCGCCGATGATCTGCGCTTCTGGTTGCGTTCAGTCTCTCGcAATTG
ATCGCCATCCGCACAGATATCGTCGTAGAGTCGCTCGAAAATGGTCGGTGCAAAGGGCGTGAACTCGGCTGCGTAtGTCCACAGGGCAGTGCAtAACTCG
TCCCATTCATACTCGGAGGAACCACTCGCACAACAACTCTTCTCGGCCTCTAACACGATCTTGTCGATGGCTTCACCAATTGTCGTCACATATTTGTACA
CTTTCTCCACgACCACTTCGTTGTTTTGGTCCTTGGACCAATCCGCCATGATCTTCATTTTCTTCAACTCTTGTCGAATCTCTTTCAACCTCTTACTTGG
CTTCCatttttCCATGTACTCGTCTTCACTTA