Description :
From Genome Similarity Track
Location :
Scaffold_26:65316- 67475
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009535Protein of unknown function

Sequence
2159 bases(100 bases per row)
GCGATGGTGGCTGCGCACAAGCAGTTCATCCATGGGTTTATCGAGCAGAGCCGCGAGCGCGTCGTGCAGGTGCGTGCGGGTCAGAGTCTCGCCAACGTGC
TGGAGACGAGCGGTGGCAGCAATGCCGTATCGCCATCACGTTTAAACCACTCTCAGCACAGCAATGCGAAGAAGAAGAAGCACAAGCAAGCGGCAGATGC
GAGTCTACCGAGCATTTCGAGCCCAACGATGGGTCTCGTGTACGAAGCGAGACGGCATGCCAGCACTCATGCCGCAAATCAGAATAATGCGCACACAAAC
AGTAATGCGAGCGTAATGAGAACAAACTTGCGCAAGCGAGGTGTCGTGGCGAACTCGGGCTTAAGCATTGGTCCTCCCGTGAGTAGCATCGAGACAACCA
ATGGCAATATACTTGGCAAAGGAGGTACAGCCGTTGAAGAGATCTCGTCAGTCAAGTTTCACGAGTACATGGACAGTAAGACCACCAAAGTCGAGGCGTT
ACACCAGTACGACCGGCGCAAAGCCATCGCCAAGTCCACGAGGAAGATGCAGCAACTCGCAGGCCTCGTCGCAGCAGCGGAAGAACCCGTGGACGCAGAG
GCGGCGATTGCACGCACACTCGCTGCAGTGAAGGGCAAAAACGCGTTCAAGAATCTAAAAACGAAACCAGTGCCTTCGATAAGTTCAGACTTGCAACAAG
CGACGATAGCAAAGAACCCGCACTTTGCTTTTCTCGACTTTATGCACGAAGACAACGATCGACGCAAGCATGCGCGTGTGTGAGTAGTTTTGATGTATAA
TTGACATTTGCTGCACCCCTGAAGTTCACCAGGTTCCATACCTACTTGCCTCCGCCGTAGATCCATTGGTCTGGACGAAAGGAACACGAAGAAGCGCACG
CCGATTCACTTTGGCGACCAGATTTGCTTCATCTCGGATGCGTCGGACCTGCCGCTCAGTATCGGTGACAATGGCCGAACTTGTCGCGTCCAAAATCTGT
CTGTCGGTCCCCATATGATGTTCACGATCGTACGTATATTCGAACTTCTATTGGCAGCCTTAGGCATTTACTTAGGACTTTCAGATATGCTCACAGTATG
CTTTGCTTGCTGCTGGTGTGCTCGAAAGCGCAGGTTGATTTCAGAAACCCAACTCGACACACTGAGGTGACTGCGTCGGACGAGTTCTGGCTCCGCGTCG
ACACGACTCTCTTTGATCCCGACTGGGGCTGCAGTGTTGACGAATATGACGTGAGGTCGTTGCTCAGCGACACGCAATTCTTCCTGGGGTGCGCTGGGTC
TATCGATGATGAGCGAGACACCATGGATTCGTGTTTTTCCAATGAGCTACCGACCAGCACTAACGAACATCTGCACGGCACGGCGGGAAAGTACGCGCTA
CCACGGCTTTCCCTAACGAGACAAAAGCAAGCTCGCAGAAACACCAGCGAGTCCCATTCGCATGACACTTTCCGGCTAGTTGCAATGAAGGCCACGGTTC
CAGCCGTCGAGTATTACGGCGATGATAAAGCCACGCGCGAGTACACGATGGAGACCAACGAGCACATCATGCGGCTCGCTCGGTGGAAATTCGCAGCGAA
CAACGAGTCCATCCACGGGTCTTCGTCGCTACCAAAGCCCCACAATACGAGTACTCCACGTATTGATACCACTTGCGAGGAAAGCCTGCTCCTGAATTGC
ACGAGTGTGTACCTGTCGTTGAATCATTTCATTGTGGAGTACGAGCGCGACTGGGAGCGCGCCGTCATGCGCGATTACTCGAAACGATGCAATGGGCTCG
AGGAAGCGATCGACTTTCTCAAGAAGCGAGGCAAACGGCAGGCGTTGCCAGCATCCTGGCAGATTCGACTTCTTCATCAGGGACTTCGACCAGAGTCTCC
GACAAAAGCAGTAGCGAACTCGCAATTTGGGCCTCGCAGCAACAGTCCCCTCAAGGTACTTGGTGAGATTACGGCGTCCCCCATCGAGTGGCTACGCACC
AAACACGAGCTCATGGAGAAAAATGAAGCGAAAATCAAAGAGAAACGCTCTCTCGTGCGTGCTGCCAAGCAATCGTACGAGCAAGTCGCGAAGCAGAGCA
ACTCGAAATTGGCCGAGATCGAGAAGCGAAAGGCGCAGCACCAACTTGCGTATTTCCAG