Description :
From Genome Similarity Track
Location :
scaffold_83:65315- 69284
Transcript NameFunction/comments
Pl_110196hypothetical protein PHYSODRAFT_323480
Pl_110197hypothetical protein PHYSODRAFT_474316
Pl_110198hypothetical protein PHYSODRAFT_472429

Sequence
3969 bases(100 bases per row)
TCATATACCAAGCAAAAACACCACATGAGCAGCTACAACCGATGAGTTTGTCGGTGCCATTGTCATGTCGTGTAGTTTCGTGTTGAGTGCCTGAGCAACG
CGAGCATCAAGTTGCTCAAACTGCCGTCGATCATTTCTGATGTCAGCAGCCCACCGTTGCAACCACTGTAACACCAACCAAACATCAGAAGAATCTTCGT
CTTCGTCACTGTCTAATAGCGACAAAAATGCAGTACAAAGCGCATTACGCGCCATGGTTGATAATGTTGCCATACATGGACTCTTGATCATCGTCATCGT
GCGTCGTAGCAGTTCCAAGTCGTCTTCGACTATACACAACCGGAATGCAAGTTCGTATTCTCCACACTGCGCCGCTTGCACGACAGCTTCGGTACGAGTG
AGCTCGAGGTTACTAGCTGTATCGTTATTGTCATTATTGTTTTCACTGCTCAAGGCAGTATTGTCGTGGTTCGGCTGAAAGAGGTTGACATCCTCGGATG
GGCGAATTGCTTGGGATGACCGGCGCTTAGGTTGAGATATCTGAGGGATATCCTGAAGTTGGGCGCGTCGTAAACCCGTTTGTGCTCTTTGTTTTGCTAC
AAACTGTTTTAGTTTTGAGACGGTTTGCATCGCCCCTGAAAGCGATCGTGCACGTTGATCTGCAACAGACGATCTTACTGCCACTTTGTGCGACGTTGAG
TCTTTGCCGCCTTGCACTTGTTTTGGTTGATTATCGCTGCTCTTTTCGTCTCCTGGTGGCGGGTGTGCAGCTTCATCATCATTTTCAGGTGCAGCAACTT
GATCCATGACTAGATCCGTGAACTTGTCATCATCTTGAGCAATTTTTGTTGGTACCCCACTAACCGCTATTGCTTCTCTAATTGTTTTATTGTTTGGTGG
TGCAGGGACAAGATTTTTGTGATCGACACTGTGAAGTGATGTCGGGTCCTCTTCGTCATCAAAATCATCAAACGAGGGCAAAGCCTCATCGCCTACAGGT
TCATCGCCAAAAATCTGGCCATTTATCCCTTCAGTCGCCTCGGACGGTAAGAGGGGCGAAGTTTCCTTTGATGCTATAGCTGAGGCGATGTGAGTATCTT
GATTTCTGCTCACTGTTGGTTTTGCCCACCGCTTACTAGTAAATGAGTAACCAGGAGGATCAGGCGGGACGAAATCATAGTTGTCACTTGCGCTGGATTG
GAGACCTTCAGTGGATTGGGGGCACAATTTTTCCAGGCATTCAAATGCCATAGCTGCAGGAATTGCAGCCTCACGAACGAGAGAAATCGAATCGTGGCGG
CCGGCTAACACGAGAGCTCGAACTCGTTCCTGGAAATACTAATATGTAAGACTCGTAGTTACCAATGCTACTTATTTTGTGCAGTACATCTACGTACCAG
TTGTGCTTGAAAGTACTCTTTTGCAACGACAACAGTGGAGCACCAAGCCGACTCCTGCAAAGCGAATACATCAAGTAGTAGAGTTAATAGATCCATTCCA
CGTTTACGTAGCATCCAGTTTTCGCGTGAGGCACACTGGAACACATCCTCGATTGATTCATAGATTGAAACAATGTGCGGTACGAAGTCGTCGCCCAATT
CAGCGAAAGACGCTTTCTCGTTAGCGTCTCGTGCTAGTTGACATGCCGTTTGCAATAGCAGAAACAGCGACGAAAAGCTAGCAAACATTGTGCTCCCATC
CATTTTCTCAACAGTGTCGGCCACAAGAGTCTTAAAAAATGGACGGATCCGCGTAGCATGAGCTAGAATTGTGGTTGGACCTGGCACGGATACTCCATCG
AAATCAACAGGGCGAAGCATACCACAGAGACATTTGGTGGCTGCTTCGCCTACAACATTTGCCTCCATCGCAAACACAGCAGCCACGGCTTCAAATGGTT
GTTGAGTTGTACAAGTTTGACCACCAGGGAGATTTATTGTGGGGCACGGTAGGACGTACAACGCAACTGCTGACACCAAGATCACACACGCATCCGTTGT
CTTCGCATGCCTGTCGCGAAGACGAAGGCATGCATAAGATAAAATTCGCGGTAGGAGCCTTGCAGATGGCACTGGGTGGCATCTGCAGAGCGCTGCAATT
AGAAGTACGAGCATTCGTCGAGTAGACGAACGACCAGGTTTCTTCAAAAAGTATTAGCATCCTCAAACACCGTCCAAATGTCTGAGTGAACACGATTTAC
CTTATTCTTCTCGATCATTGTGTACACTTCCTTCACCAAAGATGTATCTAGCCTCGGTAACGACTCACTTTAAAGAAAACAAAACCATTAGAAACTAATG
CTACGGCGATGTATGACGGAACTCTTACATGAGCGTTGCAAAAGCTTGCTGCTGAGTATCTCGGTCTTCCAAACGACCAATTTGGATGTTCAGGTTGCAT
ATCTCCTGTGCCTGTCGTTCCTTAGTTTTACGGTCCTGCTTTTTCTTCTTGATAGTACCTTTTGGACTCAAGCTACCCCTTAGCGGCCCAGCAACACCTG
CAAGTTTTCCTGGTGTCCGTCGTTGGAAATTAGCCTCCTTCATCCTTACAATACAAATGCAGTTCAAGATGGTAGTCAGCTTTCGTAGTGAACGATCCTA
GGGCTAAACGAAAGTAAAAATACTAACCCCCTTGTTGGGGCTTACCGCTAAATATTGACAGTGAATTGCTTTCATACGCTATCAAACAATGTAAGGCCAA
CTAATATTGGTAAGCTCTGTATGGGCTACGAAGAAGATCCTAATCAGGTTAAAGACTTTAGGAGCAACATTATTGATCTGTAAAAGCATCTATTTATCAA
TAGAGACCTCGGTTGAACACTCTACCACTGATAGTGACTAGATCTAAGCTTGTTCAAGGCCATCGGACCACTTTCCACCCGTACCAGTTGGGTCCATGGG
GTCAATAGCTCCATCATCACGCTTGTGTCTCTTATTTACGTGTACCTGGGATCCAGTTGGACTTGTATTGCCCTTGATAGCTGCAGGGCGTTTATTTAAA
TTTGAAGACACACCACTGCTACTCTTCGCTGACTTCGCTTGGTTGCTGCTCGTTTTAGCATCTGGCTTCACACGAGTGCTTGTACTATCGTTGCCTAGTG
ATTTGCCGCAGCCTTTTAAAATGCTATCAAGCTTTGCTTTTGCCTCAAGGGCTTGCGCTATCATACCAATCACAGTCAGAAACACAACGTTAGCATTCAA
CTAGAACCCCACAGTACTCTCGTTTCTCACCCAAAGGTACACTCTTTACTACTGGTCGTATCCACGTCGTCTCGTTCGTCTTTCGATTCCAATAGTAAAC
ATCTCCACTCGCTGCATCCGGCACTTCTTCCCATCCACTATATGACAACAACCGTCAATTTACAAATCTCAAGACAACACACTCTACATACTCAGTTAAC
TCTTCCGTCTTGGCTTCTGCCGTCTCCACTTCAGTCGTCTACATTACCATAAAACTCTTAGATACCATTTTTTAGAATTCACCATAACCTTTGTACCTGT
TCAGCCCCTGGTCGTTCCCACACTGTCTCGTTCGTTGCCTCATTCCAATAGTACAAGTCTCTTGATGCAGGGTCCACCACCTCTCGCCATCCAGGAGGTA
GGGCGTTATATTCTGTCGTCTTCATTTCTAACCGATAGCTCTCGGTCATCTGCTCGATCTGTTGCGTCTGCTGCAGCTCCTGCGCTCGTCTCATTGCTAC
TGCATGCAGCGTATTGTCCCTCACTCGAGGATCAAACCTGTCGGCTGCTGATGCTTGAGGCTGCGCGCCCAATACGCGACGTTGAGCTACTGCAGTTGTG
GCATTGGCAGTCTGTTTCTGTCGGAGTTGCTGCTGCTGCGCCAATTCTCGCTGACTGGGACCGCTACCAGTGGATTGCAGGTACTTGAGCGCTTCAGCAC
GTGCCTTTTGAGCGGATAACTCGTTCTTGAGCCGCTCAGCTGCGACAGCCTTTGGTGGCATCAGATTGC