Description :
From Genome Similarity Track
Location :
Scaffold_18:65310- 69058
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_18-fgenesh-gene-0.30Ran-binding protein (RanBP10)
Pytve_DAOMBR484maker-pve_contig_18-snap-gene-0.51Ubiquitin protein ligase E3 component n-recognin 2

Sequence
3748 bases(100 bases per row)
GTTGAGCGCCTCCCATTGCCGACAGAAGATGCCGCGCCAAATCTGAGGATGCCGCGGGATCACGAAGCGCGCCGTCGTCGCGGACGCGACCGTCATAGCC
TCGACGTCGCGCGCATTGGCGAACTCGAGCACGTGCGCGAGCAGGTCTTCGCTCAGAGCGTCCAGGCTCATGGCGGCTCTGACTCCTGGTGCTTGGTCTC
AAATTGGTGACTGGCGCTTGACAGCGCAACCGACAAGCACCGGACAATTACATCCATCCAGCCGCTGGCGCACGTGCATCGCTGCGGCAATCGGCTGGCC
GAACGCTCCCACGCGCAACATAGACAACGCGCCGTTATCCGATGCCCCGTCCCATCCACCATCCTCCAGTCCCCACACGAGGCGGCGCAAATACCGCGAG
GGTATCGTTGCTAAAGTTGTCACGCCAGGCTTTTCTTGGCGGGCGAGCGTGGCTTGTCAATCGGAGGCGCAAAAACCGGCACGCGAAGCAATTGTTGAGA
TTGTTGAGATTGGCGTCGCCCCAGCATGCACGCCTCACATATTCGCTCCATCCGCAAGCAGCAGGCGATGGCGCTACACCGTCGCGTCGCATTTCGCATT
TCACGGAGTGGCGCATACTGCGCTTTTCTTTGTTTGGTGAGATTCTCAGAATTGTGGCACACATCAAATGCTCATGTTGAAGCTCTCGGCCACAGTCCGG
TGCACTGCATCTCGTCTCATCAAGCACGCGGACGCAGAGATGATGCTGTAGCATGCTGCGTGCGCACTTCAGAATGGCAGCTCTTTGCGTCCATCGAGCT
GGTACAACCATCGCTGAGGGATAGGCACATGCTCCTGCAAATCAAGAGCGTGCTGCTCAACAGCATACTGACACTCGTCGTGTGGACCCTTCGACTGCTA
TGGGAGGTAGCGTGGTGCGCCGAGGACGAGCTTGTCGTCAACTGTGGCTCGTTCGATGTGTTGCACGCCGCTCGAAATGTTCCCGCCTGTGAGCGAGGTC
CCCATTATGCTGGTGTTCGAGCCGCTGTCCACCAAGCTTCGATTGGCTCTTCTAAACAGGAATCGTTCCAGGTATAGGATTGACAATTTGTCGAATACCG
AACGGGTAGATAGCCGTTATGTGACAGGTGTCAGCACTTCTCTTCGAAGTGTTCGAAGGTTGCGCGAAGGTCCGCTCTGGCGTCACTGGTCGCCCACGCA
CCGGTTCGCAATAATTCGTGCCGGAAATTGCGCCAAATAGCTACATTTTAATACTATTCCGTTTCCCTGTGCACGAAAAGAAAGCTGCATTTGTCGCTGG
TGCGCGATCACTCGCAGGTAAAAGGACGGAACGCACGCGACTCCTCTTGGTGCCAACGCGAGTGGCGGGGATCCAGCACAGCTCAGGCGGTGTCGACTCT
CGGGTTGATCATCTTGATCTGCTCTCGTTACCCGCAGAGGCATACGCTCGGCGGAGGTATAGACCGTTCGCGTCATCAGCAAGAACACGATGGTCGCTCT
GCGTGGGCGGAAGACCAGCGCCACCGCCAAGCCCAAGGCGGTGGAGAAGGCGGCGGCCGGTGCCCACGCCAAGTCAGGCAAGGCGAGTGGAAAGGAAGAC
TCGGCGCATGCGGAGGCCTCGGGGCAGGCTCAGGCGCAGCAGCAGAAGCTCGCGCTGCGCAAAGAAGAAGAGTTTGCGCAGATGCTGCGGTTCGCAACGC
GGTCGTCGCTGGCGCTTCGGAAGATCCCGGCAGACCAGACTATTGCGAGCTTTTGCAGCGGGCTGCTGACGGCGTGCTGTGGCAGCGGGAAGGATCGGCA
TCTGACGCCGCCGCAAATCTTGGCCAAGCTGACGCGCACCGCGAGGAAACGCGTGTGCGGCGCCGTGTTCTCGGCCGACGAGATCGCGTACAGCTGCCGC
AATTGCCAGCTCGATGCGACGTGTGTGACGTGCAAGGATTGCTTCATGCACAGGTTGGACGGTTCTCATGGCATGATGGTTTTGGTGGTCGATTTTGAAG
CTGAACCGAGTTTATGGAATGTTCGTTCTCTAGTGACCACACGGGCCACGATGTGTACTTCCAGCGGACAACTGCCGGTAGCTCATGCGACTGCGGTGAC
CCTCATGTACGTGTCGTGGACTTCGTGTCGAGCACGTCGGTTCTGAGGGGTTCGCTAATTGACGGTGTGACGAACTGTTATTTTGGCAGGCATGGAAACG
CAGCGGGTTTTGCTCCAAGCACCAGGGAATGGACACGTCCGAGACTGGCGCGTCGCGCAAGCACCGGCTCCCCAAGTCTCTCGCTTTGGTGGCCCCGGTT
GTGATTGACGCGGTCATTGAGCACGTGTACCAGGTGTTGCTTGGCGTGCACTATGGTTTTGAATTGGCGGACGCATTTGAGCTCTTTACGCGGAACATTC
CGCCCGAGTTTCTGCCGATCCACGCGCAGTCGGAGCTTGGCGAAGGTGACGAAGATGCTGATCATCATGGCTCTGGTCGATCCAGCGCACCATCTGGTGT
CTCGACGACCAACAATTCACCTCTTTCTCCTCTCGACGCCTCCTCAAGCGGAAATGTTGCCAGCGACAATTCCATAAGCAGCGTCGCTGAGAACGCGGAT
GATTCTCCTGTGGTGTTCGCGATCCGCCTGCACAACGACGACTGCCACACCATGAACGAAGTCGTCAACCATCTCTGTGTGGCGCTGGACTTTTCCAAGC
TGTCGGGCAGGGCCGTGGCTGACCAGACGGATCGAGTCGGCGACGCTGTCGTGTCGAAGCGGGCTCTGCTGAAGTGTCCTCTCGTCGTCGGGAACCTTTT
GCGGCGATCGCTGAACATCTCCGTCGTCCCTGTGTGGCTCGAAGCCCAGCTCCAAGATCTGGCCGACATATTTGGATGGCTTCAATCGATCAGCACGATG
TCGGACGGACTGGGAGAACTTGTCTCGGAGGCGTTATCTAAGAAGCGGAATCCCGAGCTGTCGTTCTTCGACAAGTTCACGAGTGAAGCCGCCAACGGAC
ACGATCTTGCGCAATTTGCCAAGGAATGCGGCGTCCGACTGCACAACAAGGCCGCGAGCATTTTGGAGTCGCTGGTCGGCGTGGACAACGATGTGGGCAA
GTGGATGGCCGAGTTGGAGTCGAATCAAAAGCAGCACTTCAAACTGTGGGCAGCTGGGAATGCGTCTTCATCGTCGCTTCAGCTGGCGTTGCCGTCGGCG
TCGCATGGGCCAGCACGGTGCCAAAACCTATTTATCGAGGAATTCGTCAAGGCAGTGTCGCAGAGTGGACCCTACGCGCGGCATGCAAGCGTTCGCGAGG
GGTTCAACGCGGTGGTCAGCAAGTACTTTTCAGGGGAAGCGACCGGATCGGATGGCAGCGCGGACACAGCGTTCTCTGCGCTGAAGCTGCTGGTTCAATA
CGACTGTACATTGCGGAAGGCAACTGTGGACCAATCGCATGCTCTCTTGCGTGAACATTTGCTGGAAATTGACTTCCGAACGCATTTGCTTGAGGCTTAC
ATGCAGTGCTACAAGAGGATGACGAACATGTTCTTGCGCGGCCTCGGCAATGCCAGCGAGTCGATATTCGACTTCGCCGTGCAGTTTTTGACGGTGCCGC
AGCTCGTGAAGGGGTACACCTGCCAGGAAGCCAGCAAGCACGAGGGTAGGCGGCAGATCATCGGCGAGTTGCTGGAGGCATTGCAGCTCGTGTTCAAGTC
TGCGATCGACCCCAAGACTGGCTCATTGAATCCGGACCATTCGTCGCT