Description :
From Genome Similarity Track
Location :
Scaffold_2498:653- 4760
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2498-snap-gene-0.1Protocadherin

Sequence
4107 bases(100 bases per row)
AGGATCCTCGCTGCTACACGGAGAAAGTTGTGGACACACGCATGAACTACCCGAGTGAGTGTTGCGTTTGCAGTCGCTCGTTTACTTTTTCTCACCTAGA
CACTATATTAACATCTCTCGTGTTCCAGTCTCGCAGAGCCCCCTCGTGAAGATCGAGTACACGTCCAAGAGGACCACAAAAGCTTACAAAGGCGGCCAGG
GCAAGGATTTCAAAAGCGACTTTGACTCCGCGGCGCAGCCTGTGGAGAGCGAGGGCTTCTGCCACCGACAGCTTACGTCGCTAACGAATTTCTACAATTC
GAGAAGCGACATCTGCGGACGAATGGCGAAAATCAGCAGTGGCGTCGGATTTTTGCTCCAGATCGAGTTTGTCGAGTCGGCGCCGACTGCGACGAACTGG
TCCTGGTATCTTGGGCTGCCATTTCGAGTGGGGAGTGGTGGTCTCGTCGCGCTGGATGGCCAGATCGTTCAGGAATTCATCGGTGTCACGACTTTCTGGG
GAGGTGTGCTCTCAAAAGCTCTCAAAGTAGACATACAACTCGCTCCAGGACCCCACGTGCTTCAGATCTACGGGATTTCGCAGGACTTTGAGTCGTCAAA
CGTGCTCTTCAGTCGGGAGGGTTCGACTCCGATCACAGTCTCCACCAGCACGATTGCAAACGATTTGCTGAAGTGGGTTGCGGTCTCTGATGCTGACGCC
ACAGTCGCAGTAGCAGCTCAGAAGGAGCGAGTGCCAACGACAGGCGACGTCAGTCGGAGAGTGTCCACACTCCAGCTTCAACGACTCGCCACTGACGCGC
AGTTTGCAGTGCGTCTACGCTCTGTCTCCAACACCAACTGTAGGTTCACAGACTCCTTCAACTCTTCATCGCGGGTCTCTATAGCATATTTGCCCGCCAG
CTCTGCTACCACAGCACGATCGACAGAGCTAGCTTCGGTGATCACACAGAAAGGAAAATGGGACATTCTGCCGGGAGTCGCTACGTCACCCATCTCAAGA
TTTACCCCAGGAGTGCTGCTATGCGCATTCACTGGCCGGTTCTTCATCGACGACACTACCGCAAAGAGTTTCAGCGTGGACTACGCCTTCGCACTCAACC
GTTCCAGTTTGTCGACTGCAGCACTCACAGGCCAGTTCCACTTGGACAGTGCATTCATTCAGCCGTCCGGTGCAGCTTTAGATTTCTCCACCTTTATCGA
GCTCCCTGACGCTAGCACCAACACCTTCAACGTGTCATTGAGTTACCTGTTCACGGGCGCGAAGAGCGCGAAGGTCGTCGGCGGAAGAATGACAACAGCG
CTTGTCCCTGGAGCCTCGCTCACCAGCATCAAGGTCGACAATACTATCGTGACTCAGTCAGCGAACGTGTTCTCCCGCGACGTGCAGGTCGTTCTACCAA
GCACACTGATCGTTCGCGTCACCGCTGTGATATGTCGGAACGCAGCAAATGAACAGCTTCTCGCACAGCTGTCCAAGTCAAACAGCGCTATTTACGATGG
CGTATTCTCATCAATCTCCAGTTCTGCCACTTTGGGGAGTTGTGAACCAATGGTCATGCATGCAGTTGTGGATGCCAGCGTTGGGTTCAACAAAATCTCG
CTCGATGTCACGACGTCGACAAAAGCTGGGTACCAGCTAAAGGATGTCACTGCCCAGATCGTCATCGTCGACCGTGGAGCGCTCCTGTCACTAGACGCTT
GTAAGAGCGCGTGTGGACAGCACAACCTCTGCAAAGTTGGTGTCTACAGCAGCATTTCCAGTGCGTGCAACCTGTTCATGGCTCAAAACCAGTCGAAGCT
TCTAGGAGACGTGACCAAGACAACCTTCATTCGCGCAGTGGACCCAGGAGCGAGTGAAAACGTGTGGATGACACTGCAGAAGAGACGATGGGAGCTGGCA
TCGAGCGATCCACTGCTGCTCAAATGCAGTAGCGATAACAGGTGTGCATCTTTCGGCTGCTCAGGTGCTCACACTATCGCAGATCGATGTCGTTGTGTTT
GCCGCGGCACGAGCGATTGCGTGGGGTTCAGCTACGAGAATGAAAAGTGCTACCAGCTCACGTCAAGTGCGCTTCGCCAGACGGTCGTGTCCAAGAGCTA
CGCCCACGAAGGCAAAGCCACGATTCACTTGAATGTCCCAAGGAGTTGCAGTGTAATCAAAGCGAACGCAGCGAAAGCCACCAGTGGGGTGTACGTCATT
GCCACAAGCGTAGGCTTCGTCAAAGCGTACTGCGACATGGTCGCCGATGCTGGCAAAGGGTATACTCTTGTCCCTTGCGACTTTGGCTCGAGTGATGTGG
CCTGTCGAGCCACGACTGGTCCAAGTGACTACGACAGCTGCAAGGACATGGGACTCTCACAGGTCGTACCGCGCTCCCCGAGCCATTTCATGGCGATGCA
CAGGAGATTCGGTTCATACTTCTTCGCGACCGTGCCTGGTGTCTCGAACGCCGTCCTCAACACAAAGTTGGAGTTTCCATCAGACAATAGCGCAACGTCT
CAATGGAGTGCTATCGATTCGGGCAAATGGTGGTTGAGAGACATCATCAGCAGCGATGACGACTCGATCGCAGTCACGAATCGCGCAGCAAAGCGGCTCT
GGCTGGGGATGCACGCGTACGCCGACTCACAAAGTGTCAGCGACGGCATCATGCTGAGCTTCGATAGCCGTGGCATTCAGACGACCAAGTACATCTGCTC
CGCAAATGACGTCACGCCATCGACACTCTGGCGCACGGTGATCCAGGACTCGTTCAACGGCAACCGAGACGACAACCTGTGGGTCACGTCATGGGGTAAC
ACTGCTGACAAGTGGGGCCAGATCTGCCAGGGCATCACGATCCTCGGCGGACAGGCATTCACTCACTCAAACGCGTACGTCGAGAAGACTGTGAGTCAGC
TGAACAAGGGACTTCAGGCTTCGAACGTGCGGATTCGGTTCACGTACTACTTCGCCTTCAAGCCGAGCGTCTGGTCGTTGCTGCAGAAGCTGACGGGGGC
GGCTGCGAACGCGAAGGTCATCCGCATCTACTTGGGTACGCGACTCGTACGCGAGGAGCTCATCGATGACTCGAACGTGTACTACTGCAACGAGAAGGGC
CGAAACGATTTCATGTTCTATCGCGCGCGCAAGAGCTTCGTGGTGCGCGGCGTGACGACTGCGAATGGCGCCGTCACGTTGCGCTTCACAGTGGACGTTG
GCTCCGCATCAGTGCTCTCGTTCGGCATCGACGAGGTCTCGATGGAGATGGACTTCACGTTCCAGTCGCCAACGGGACTCTCTCCTGACAGCCCAGCGAC
GTCGTGTGCTCAGTTGAAAGACGAGCGCGCAGCACTCGGTGATCCGAACCCTGACGGCCGCTACTACATCCAACTGGACGCAGCGTCGAGTCCGGTGTAC
GTGCCGTGCTCAGACGGGTGGCTCGTGGTCCAACGGCGCGCCAATGGCAACCTGGGCTTCAACAGAAAGTGGAAGGATTACCGCGATGGCTTTGGGATGG
GCAGCTCCAGCGAGTGGTGGATCGGCAACGACCTCTTGGCGGCCATCACGAGGCAGCCGACCGAGGCTATGTTCGTGCTCTCGAAAGCTCAGGTGTCCAC
TTCCGCGTACTATGCAGACCTGCGTGTCGCTGGACCCGGTGATAAGTACCTGCTGCGCGTTCGTGGCTACGATCCGAGCATGAGCACCGCCACCGACGCG
CTGTCTGCACTCAACAACTCGTACTTCAGCACGCCTGATCAAGACAACGACCGCACAGCTCGATACAACTGCGCGCGACGAGCGTACAGTGGTTTCTGGT
ACAACGACTGCTTTACGAGCAAGTCGGACCTCAATGCACCGTACCAGGTTGTCCCGGCGTGCGCGACGTTCGTTCCTTGGGCGCGCGACTGGTGCAAACG
CACAGGTGGCATCGTCTGGAACAACGCTGACGGCTATGATTCGTCAGCGCTGCTGCTTCGCTCTAGTGGGTGTCCGTACGGCTCTTACTTCCGTGTTGCC
ACTGCTACTCCAGGTTCAGCGAGCGGCTGTGCTGCTTGTCCCATGGGCACGTACGGCGAGCGTCACGCCCAGGTGTGCACCAGCTGCCCCGCCGGCACGT
ACAACCC