Description :
From Genome Similarity Track
Location :
Scaffold_103:65296- 68110
Transcript NameFunction/comments
Hyaar_Emoy2809517AlNc14C264G9866

Sequence
2814 bases(100 bases per row)
TGATCATTTCAGGATCAGGGCGCAAGCCGCGCTTACCCACGATGCACCCAAGAAGTGGCATTTCGCTAGCTGCGAATATACACTTCTTGAGGTTGGTGTA
CAACTTATGCTTGCGCATAAGTGTAAGAACCTGACTAACGTGTGTTCTATGAACCTCCACGTCCGTCTTTCCATCCATAGCCGACTATGGACGAACGCAT
CATCACAGAAGCTCGGTTCGAAATTACGCACCGATCTCAACAGATTTGTGACAAATCGGTTAAACGTGGGATGCCACGGGGGCGTTGCTAATCCCATGTG
GCATCACTAGCCACTCCCAGAGCATACCGCTATGGGATCTTACTGCACTGTATGGGATGTCCCGTTCAAGCATTAGGATCTGATAGAAGCCATCCATCAG
ATCCATGGACGAAAAGATGATACTCCTTGACATCAATGATTATGTCCTTCCTCGGTATTGTCTTCTGAGACGGTAGCGTTGCAACATTCAACTTGTTGAA
TGCATGCACAATCCGCCATTATCCTGTAGCCTTTGCACACAGAAGGTTGGAGAGCCATGTGTAGAGGTGGACTCCCTCACATGGCCGGCTGCTAAGCGAT
CTGCAAAGAATTTGTCGATCGCAACAACTTGTTCACAAGGCAGTGGCCACTGCTTCATGACACAGTAATTCGAGTCCGGTATGAGCTCGATCTCGTGTCG
AGTGCCTTTATCCTTAGGCAACTCGCATGGCACGGATTCAGGGAACACGTCCTTGAATTCGATCAAATCCTTGTACAAAGGAATTGCCTTTAGAGACTCC
CAGGATTGAGACGTATATCGCTCCTTCCGAGCCTTCTCATCAAGGACACTTTAGTCAATCGATGAGCTGCTGAGAACCCGTTCGTTCTCAGCAAACATCA
CTGCCGACCGAATATCGGTCACGTACTCGTCCTCCGCGACGAGTACGCAGATCTGATTGACTTTGCCACTACGCAGATCACGTAAGAACCGTTTTTGTTC
TAAGGTTGGCAATTGAGTTATCTCCAAAGTCAACTTCGAAGGCGCAGTCAGATCAAGCGTATAAGAGCCTTTGCTTGATCCGTTATTGACCAAGACATTC
AATTTCTCGGTCTCTTCCTGGGAACCTATTTTCACAGGTTGCTGGGGGCCTCTTCCCGCAGCAAGTACCGCTTGAGGAATGACTTTCTCAAGTACGTGGG
AACTTATTTCCTCAACGTCTTCTGACTGTAATCGCGCTACTACAGTCATATACTGATCATCTACGGTCGACTCTCTTGTTGACCTAGGATTTTTATGTTG
CCGCTTTTGGGCAACCGGTTTCTTCTTCCTTGGATGCTGCCCGCTAGGCACGCCTCCATGTCCTGGTCCACTCGACTTATTCGAGTGATGGACCTTCGGA
GCTACTTGTGCACTAGCACAATCGCCAGGAGCATACTCTACAGTGTAGTGATCAACTACACTGAGATCTTGTGCGGTTGTACTAACGACCGTATAAGAAG
GAAGGCCATCGCAATCACTCGTTGTACCACACGCTTGTGGGCGCTCCAATATGTTCATCAGATGGCCATCTAATGGACAAGTGGCAGGCATCTTAACGGA
TCGATGCTGCCAGCTCACGCTTGGCTCGTACCTTCTGAGCCAAGGTAATCCCAGGATGACATCAAATTTGTCATCCAGATCCAGTACGATGAAGTAATGA
TCGTACTGTTCTTCTTCTAACGTGTAGTGGATGCCTACTACACGTTTCTTCACGATCATCGATAATTCTGGTGCTAGGCGCTCCTTCATCCTCGTAGGAG
GGACTTCTCGCTTAACATAGTTGAGCGCATCAGCCTCTAGTGACTGGCGACGAACAAAGTTGTTCGAAGTCCCACAGTCAACTAGGGCGTGAAGCGGCAA
GTTCTTTGTCACTTCCAACTTCAAGGTAATGAGGGATACCTCATCACCAGGTGCAACGACACACAGCGACTGTGTGCCGGGAGCAACCTTCGTCAAAAGA
TTTGAAAATTCTCTTGATGTTTCTGGATCAGTAGGGCACTCCGCCCCTACTGACCCCGACCATTTTTTTCTGGTGCGTTTCGCTGTTGCGGCTTTGCAAC
AGCATCGGACCCTCTTCCACCGCCCTACCTGGCAGGTGGACGATCACTTCGCTCAGTACCGCGAGGTACTGCGCGTGGGGGACTACACTCATAAGCGTAG
TGTCCTAACTTGTGACAGCAATTGCATATCTGCGATCGCTTCCCGTTTAAAAAGCGAGGTTTCTCGCTTTCAACATAGCAGAGGTCCATAGGTTCTGGAC
CTCCCGCCTCTCTTCGTTTGAAGGAGGATAGGGGATCAAGCTAGTGTGAGCCTGTCTCACACTAAAATCTTCCTGCACCGCAGTTGTAATTGCTTCCTTA
AGCGACTTCAACTCGATGCGGAACAGGTGGTTCCTCACGGGACAATTTGTAAGGCTCTGTAAGAATATCGTGATCAACACAATTCGCTTACAGGGTTCGC
TACTATGCAGCTTGCAAGGTAACGAACATGCTGAGCGTAAGCGTGAACATCACGCTTACATTGTTTTATCTTCAGGAACTCTAAAAGAGTCCTGAGATCA
GCTCTTGGCGGCTCAAAGTTTGGCTGAGCAGAGTGTTAAAATCCACCAACGATCCAACACATTCGGATCGTGTTAATGAAGGTTCAGGGCCCAAGTTCTG
GCACGCCCTGACAAGTTTGACTTGACAAATGCAACTTGCATTTCATCATCATCGATGTGGCGAGCCTTAATGGTATCGTCCACTTCGAGAAACCATTTCA
ACAGAGAGTCTTCC