Description :
From Genome Similarity Track
Location :
Scaffold_88:65291- 68264
Sequence
2973 bases(100 bases per row)
GTGATATTTACCTTTCTGCGGCCTTCGTTTGTGTATGAATGTTCTCCTATACCCACACATTCTTGCTTCTGACTCTCAAGTATGACACAGCCAACATTAC
GAGCAAAGGTGGTGTCAATAATCGAGACTTCTGCTCCCGAGTCGAACAGTTGGGTGGCCTTCTCTTGATTGAGTTTTCTCCATGCCCCGGCTTTCCTAAA
CTCCTTGTTTGGAGTATGATACTTCCAGTCAACACGTAATTTTCCAGGAGACCACTTGAGTTACATATTGGTGGGTGATCGTGCGTATTCATCCGGTTGT
CGCAGACTTGCAATTGCAGGAAAACAACTAGAATCCAAATTGCATGTACTGAACGTCCGGCCGCTGAGGCGATTAACACTGTTATTCCTTCTCTTTCAAT
GATTGAACACATGCATAGCCTAGAACGCTCGGCTCGTACAAGGTTCCAACCTGGCGAGCGTCCTGGTTTAACATCTGCTTAGCGTCAGGAGGAAGCATTA
CAGCATGTTTAGTCGACACTTACCACTTGCGGAGCATGTTGTAATTTCCCATCGATAATTTGCCTCCTTCGTGTACTTCTCCACACGCTGCGCACCTGTA
GAAACACTTATTAAAGGGGGTGACCTCGGCGTCCACATTTCTGGTAAGTCGATCGTTTCTAGCATTCACGATCATCACGTCTTTATGACGAGTGCACGAC
TTGTGTCCTCTTGCACGATCCTGATCACTCTCACGCTCAACCAAACTCGGCTTGGTCGAACGTTCATTCGTTCGATACGTCGTTTCATCGGCTGCCGTAG
CGCTGTAAACACGCCATTTTTCTTATTCTGAGTCTGAACCGCTTACATCTGACTCTGAAGAACTGCTGTCTCCCCCACGTGGATTGTAAGCACGGCTCGA
GCCGGTTTAGATGGACTTGTGTTGTATGGTGATGCTGATCGTGAGCGGAACTTTCTTTTACAGGCCGGGAGGTTGCCTTTGCATTTCTGCATACGTTCGT
ACGTGTGTAGCATTGCTTCCAGTGCATCCACGTCATCTAATCGCAGTAGCGTTAATTGTTTCGCGAGGTCTTGATCGTCCAGTGTTTCGATATAGTGTTC
CATATGGCCACGGTGATCAGCGATTTTTCCGTCTTTCACGTGAGTTTTCGTTAGCATTCCAGCAACGTTTAATCGATAGAGATATTCTAATGGAGTCTCA
TCGGCCCGCTTGCAGGCATGATAATACTGGCGACCAGCGGAGACGCCGCGTTTGCAGTATTGTAAGAGGAAGCTCTCGAGTAAGTCTTTCCACTTACGGC
GTGTCGATCGACCCAATTGGGAGTACCAGTTTCATGCTGGGCCTGTTAGTAGATCACCAAAAACCAGACAGTTCTACGAGTCCAGGGGATTCGTCACGCA
AGGAATCTAACCAGAATTTGCGTACCTATCCTCTAGAGGGGTCATCATCGTGATCGCGGCCTGAGCATTGTTTTAACTCGGCAATCGCAGACATGCGAAT
CCGATGCGCAGCAAAAACTACTCCTGTTATGGCCTCAGTAGTACCCAACTGGGGTCGTCGGAGATCGTCGTTATCGAGATCGGTAGGGTCAAATACGTTA
CCGCGGCTGTCATGCGAGTCAACTGATTCCATGAACACATTGTGGTTGGGGGTGGGCGACCGGTCGGTGTCGTACGGGGCGGTTGACGGCGTTGGTCCTG
TACAAACCTTTTCATAGCTTTTGCGAAGTAGATTTTCATCTGGTTTGATTCATTCTTTAAGGTACTTGTTGGGTGGTTGAACCCATCTCCCTGGTGGTCG
GTGCGGTATTCTCGTGGTGGTCGCGCAAAAGTTCTGCTCCAGAAGGTACCAACGACATTCGTTTGGTCTTTATGTTATCCCTTTCCTCTGCATTCGACTC
CGCAGAATCATAGTGCGATGACACAGCCGGATAATGTTCTTCCTCTTTGACTTTGACGGTGGTGGTGATTTCTCGATCAGTGGATTCATAATTACCGGTC
AGTGGGACCAGCGCTTTGAACAGTGATCGACTGTCCGTGGTGACATGATCCAGGTCGCAGTCAAGAAAAACCTGCGCATCGAACGCCCCCGGTACAAAGC
CCCCCCCTTGTAGCAACTGAATGAGACGTTGTACCGCTTCGATTTTGCTTGTGGCGGCTCGTGGTGCCATTGCAGGTCCTCGGGTCGGTCCGATCAGCTC
CGGGTCTAAAATCGGAAACACCGGATCTGTGGACAGCAAGATTTGAAGCTGAGTCCAGTACAAACGACGTTGTAGCGTATCCATCTTACAGCCTTCCGGT
TTGACCTCTGCTGCTCCACTTGTTTCCTGATCGTCGCCTTCGAAGTCAGGCGCTCGTAGCTTTTGAGCCGTAGCTTTCGATATTTTTTGTTTGTATATAC
TTTTGTTCTTAGACGAAACATGTCCTGCTTTGGCTGGCCGTGTTCCGTTCTAGCGGGTCGTACTTTGCAGTACGATCCGAAAGGAAAGCAGGAGGAAATA
GAGGTTTTTCTTCGAGATCACCTGAGTTATCTTCCTCTTTAATTTTCAGTTCACCCGAGCTCCTTCAAAAACTCTGACGAATCGAGGATCCTTGATAATC
ACGTGTCTGCGACGATCCCATATTAGCCGACACTTCCATCCCCGGTTCAACCTTCACCTTGACATCTTTGCTCTAAGATTCACGGTAAAATCCCAAGTCA
ACAGAAGTTCCGGGCACGCACCATTGTGGTTGAGTAAGGTTTGATCACTTTAAGAAGCGATCCCAACTCTCTACTGGCACCCGGAAGACCGACTAACGGA
GAAGGTACTCCGGACCGTGTGTCTTGTCTTGTTCCTTCTCACCTTGGGTACCCGTAGGCGGGCGGGTTGCACTCTTCTAGGTGGCTCGAGATCGATGTCT
GTCTTGATCGAGTTGGGAATAGGTGGGGTGTGGTTGCGTGGGAATTCTTCACACGATCAACAGTTACTTGTGG