Description :
From Genome Similarity Track
Location :
contig_24:652901- 660894
Transcript NameFunction/comments
g4656.t1hypothetical protein
g4657.t140S ribosomal protein S10
g4658.t1High mobility group protein 1.2
g4659.t1hypothetical protein PHYSODRAFT_508840

Sequence
7993 bases(100 bases per row)
CCGCTCGTATTCGCGCTGCCACCGGCCCATCAATCCCAAATTTAAATTTGATAAGGCAACTTTAGTTTTAACCAATCACATACCAAGAGGGACACTATGA
AACGCTGATGGACAGGGCTCCATCCTCGCAAAATGCTACGCTAATGTTTTCGTGATGAGAGTAGGCGGAAGCAGTTAGTTGGGATTCGTTAGATACTCTG
ATGCGGACCTCGCTGAATGGAGACGCGTTGCTTGCCACCGCTACCAAACACTGGGGAAGCAAAAAAAGCACTCGACCGAGCTATTGCTTCGCCTTCCTCA
TAATATCGCTCGCCAGCGAAGTCTCTCGCTACCGGGCGACCTGGCTGATAGCTGCCCCTCTGCAGCTGTTTCTGGTGTTTTCGAAGATGTTTGGCTTGCT
TGGGGTCGCTCTGCTGGGACGACGTACGTCACTACTGGTACTGGGGGTTATGAAAACAAACGAGCTCCTGCGTCTTCGTCGAACGCGGGGCTTTGAGATG
ATGGACTGGGATGACAGGGCAGGCTATCGCCGCCGCACAACGAATCGCTGGAACAAGCTACCGGTTGATTGTGTCCGCTCGGGAACTTCGTTCGCCCCCG
GCAAAGAAGCCGCCTTCTGAGTTTTGCTGGTCGTGAACGGAAACCCGCGACGCGTAGTGGCTTCTGTCCGCTCCTTTCTTCGGCAGCTTGAAGCAGAGAC
TGGCAGTCGTGGAAGCGCAGGTTCTCGGGGCTCAGCACGTTGTACACATTGTAGTCGTCTTGGGGAAGGTTCGCTGGGTGGGACGCATTCGGATACGGCT
CCGGGTGCGGGCCAAACAAAGTAGTGCGGCAACACTGGTGTAGTACCCTGACTTCGACTGCGCCATGGTTGCGAGGTGAAGACCATAGCCCGCCAGAGAC
GAATTCGAAGAAACGGTCGAATAGTTGAGTGACGCCACCGAGTTGCTGTGCTTGAGAAGATCAGATTTCAGTCCACGTGACAGCGGTACCGAGTGTCCAA
TCTGGTTGTTACCGTCGTACTCATCGTCAACACTAGAGCCAAAATTTGTGACGGATGCGCACACGGCTAGCGAGTCCAGCGAGTCAATCGCCGAAACATG
TTCGTCAGCATCGGTTCTGTTCTTTGAACGTAGAGACTGGCGAGCTGGGTAACCTGGTCATCTAGAAGCGATTCTAGGGCCGTTGAACTGTTACGGTTGT
TGTTCGAGGCAAGGTCATCGGTTGTAAGCTCCACGTCGCTGGGGTATCTGTTGTTGTTGTCGCCGTCCCGCTCGAAAGGCGGGGGCGACGATGTTTTGCG
CATCGACTCTCCTTCCGTGCTCGTGTCCGACATGCACTCTTCGTCCATTCCACGCCAACGTTGCCGCCGAGACTTGACCATCTCATAGCCAAAGCCGTAT
TCCCCACCGCTCGTCATTTCATCGGCTGTGGGTGAGTGAGCTTCCGACTGTTCTCCAAAGATAGAGTTAACGTCCGAGTTGTAGTCATGCAGAGTAGGCT
CCGAAGACGCGCCAATCAGTTTCTCCGTGTACTGCGTCAGATTGTCAAGCTGCGATCGCAGCATTGTCGAGCGGTTAATTTGCTGTTGGAGACGAATCTC
CAACATGGCGTTCTTCACATCAAGGCGTTCGCTCTTTTGGCACACAGCCTCGTACTTCACCTGCAGCTCCGCGTACGCTTTCTCGACCTCGTGGTACTTC
TCCTCCAGAGGCGTCTCTACGGGAGCAACAGGTTCTGAAACAGAAACGTCGCTCAATCTAGGAGCGCTAACAAGTCCAGCAGTGTAAGGGCTTCAATCCA
CTGAGCATTGGTAGTCACCATCTTCTCGAGCACCGACTTCATCTCCTGGGTCTCCTTCTCGAGGAACTCCAAGTGGTGGTCGAACACTGTTTGGCTTTGG
TTGTTGTGGCTACTTTGGTTGTTCACCGGTCGAGCTGGCGACGGAGCACGCATGGAACGGGACGAAGGTGACGATGCCGACCGCTGGAAAGCTGCGAACA
CGGGCGACTCCTGCTGCTGCAGCTGCTGTTGCTGTAGAGAAAGGCGTTGCTTCGTAAGGCCAACAGACGAGCGGACGTCGCCCGCCGACTGGAACGGTCT
CCGGCTAGCTAATTTCCTGGCTGTCTGCCGTCGAGGGGCCTCCAGGACACGCGAGGTCGTGGGCCCCATGGACACCGACAGTCTTCGCGCTCAGGGGACT
CTGGCGACAGGTCGGTGATGGTGAATCGGCCTCGGACCTGCGTCTTGCCCTTGCGCACGGAAGAGCTGGAGGCCGATAGGTCTTCGCAGTTGTTGTTGTC
GTCGTCTCGCGGCTGCTCCGACGCGTCCGACATGGCGCTGAGCGACGCGCTGGGCGTGAGCACGTCCAGCTCGTCCTCGGGCACGTCTGTGACTACGAAT
TTGCGCGGCGTGCGCAGCTTGCGGCCAGTGATCTTGGGCACCGAGCGGCGGCGCTGGTCGGCGGCTGCGCGCCCCAGGGGCGGCTCTGGCTGGCGCACGC
TGGGCAACGAGACGGTGCTGGAGGTCGTCATGAGCATTAACTGCGCCGCGTCGGCGCGGTGGTGGAAGAGGTCTATCTTTCCTGGGAGGAGAGAAAAGCC
GGAGCCGTTAATACAGGGGGCGGACGCCGCGCTGCGGACTCGCCACACTTCGCCTTGATGCGGAGGTCTCCTGTCTGATACTAAGTGCCGGCACCCCTTA
CTTGGGCCCATACAAGGGAGAGGGGCTAGAATCTCGACGATAGACCAGACGGGTCGGGTTTGGAAAGGCTGGTGCGGGTTTTGGGGTGATTACACTTGGT
CACTGTATGGTGTGTAGACCCGTGCTGCGATTGGCTGTAAAAATAAGCTGAAACTGTGATTTTTGTGGGAAAATAGAAAAATGGCCGGTAACCCTCTTTT
TCAACGTGTTCGGGTGGGGCTCCGTTGGTTGTGGACACGCCCTCATCCCATACTGGTACAGCAGCATTGCCGCGATTTCTTTCGGAGTCCACGCTGCGTG
CTGCATTTGAGCAGCTTTGACTCGATTTTCGGGTATTTCTGTCTGCCCGCTAGGATTTCGTTATCAAAGTGCGAAAATGCCGATAATTTAGACGGCTGGC
CAACTTCCCGCAATGTGCTCCACTGGCACGCAGCTTGCGAGTGCGTTAGCGATTCGGCTGCTGGCATTTTCGCAGCGCCAACCGGTCGGCAAAGAACAAA
CCACCTGATTCCAGCCAGCAATGCGCGCTCCCAGAGCATTGCACCGGGAACAAGCAACGCGGCTCGGGATCCCGGCGCGGCTGGTGGCGCCTGCTGGCGG
TGCGCCTGTGATCGATCCGATGCTGCGTGGCCCCACATTCACGCCATTTGGCACACACGAGCTCCGAAGGCAGGCACTCGTTTCAGCGGCAAATTTCATG
GTCAGCGCCATCGGCCATTTCCTCAACGATTTGGTACAATTCGGTCTTTGTGTAGCGCACACCAGATTCTGACTCGCCTAGGTACGTTCCTCCGGGTCGG
GTCAAATCGTTGACTGGATTTTTACCAACCCGGCCCATGTGCCATTTGAGTGGTTCCGAGCAACCACTGGTGGAGCTGCAATAGGAGCCGAACGGGCAGA
TCAGGAGCAGTTCGCGTTTTCCTCTGGGCAAACTCAAGCAGGAAGGAGTTTGTAGATTACAGGATTTTGTGTGTTCCCTAGTTCCAACTGGACTTCTGGC
GAGATCTCTCTTTCACAGTGGAGGTCCCAGGGTCAAGCAACTCGCCCCGAAGCGGAGCGCGAGCGTTTTGCTGCCGCAAGGTGGCGGATCTCGCCCGCAA
GCTCTGCGTCTTTTGTGAGGGATAAGCGACGCAAACAGTTGAATAGCGAAGTCTCGGCCGTTGAGCATCTGGACCGCCTGGCGACCTCGGTTGCCTCGCT
GGAAAACTTGCTCCGACTGATTGATGGCTCCATATTCCCAATCTTTTTTGCTAGTCACTTCGACATAATGCTGGAGACCAACCATGGAGCAAACATCCTT
GTCAAAAATGCATTTTCACTTGGCGCAGCTTTTTAAGCTTAGAAACAACATCAACTCAAGAGCGTTGTTGCAGTCGAATTCTTATCGTAGACGCAGTAGC
TGGCACTGCAATCTCAAAGGCAATGTATCAACTTTGGTGCATCAGTTATTGTTAGTGTCGACAATCCGCAGAGCTTGCTATTCTTGCTTCTGCTAGGCGG
CACACTGCGTTTGTCTGCCACACGAGCGCCAACGACCATGGGGCTCTGCCCGTTGAGCCGCATGACTGCAGAGGACCGGGAGCAGGAGAGGGTCGCCGAG
TTTGTGAGGTTCGCTATCACAGCCGACCTCGTCAAGCTGCGAGAGATGATAAGCAAAACCAAGATGGATCCCAACGCTAAGGATGTGAGTGGAGAGATGA
CACCTTTGAGCTTTGTCGTGTTCGAAGCTGATTGCCTGTTCTTCTTTTAGCGCTTTGGAATGAATGCTGTGCACTGGGGTACGCTCAGCGCTTCCTAGCA
CTATAGAAGTTGCTCACTTTGCTCCTCAATTGTTCAGCTTCGTATGTTGGTGAGCTCGAGTGTATCATTGAGTTGATCAAAGTTGGAGGTTCTCCCAGTG
CGACAGATTCCAATGGCCGCAACGCGCTCCACCACGCTTGCCGAAAGGACCATGACGAGGTCGTTCGCTATTTAGTGTCCACTGCCAACGTGGACATCAA
CTCCCGTAGTGAGAACCAGGACACGCCATTGCACAAAGCAGGTTACGCATGAAAGTTTGGTTCATTTTTTACGTTCGAAGGGGCTAACGTCGTTGCTGCA
GTTCGAGGGAAGAGCGTCAGGGTGCTTGAAGTTCTACTAAAGCTTGGTGCAGACCCCAATCTCCGGAACGAAGTACGTTTGGCTTTATTTGAAGACTCCT
AGGTAATTCACAAAATGCTGACTTTTGATGTGAGCTTAGCAAAACAGGACCCCTTGGAGGAACTGGAAATGTCCATGACGACATTGTCGGTACGCTTTGT
CGGTTCTGTATAGTGGATGCTTGGGCTTATGTGTAGCCATTGTAGACGGAAAGCAACGACTCAAATCTCGTGACGTCTGCAAGGATATCAACTACCCAAG
TCTATCGCGAGCCTCGCGACTACATTGGGCTTGCGCTCCAGCCGATAAGACGCGGAAGCGGAAGTCGCGGTGTGGATCGCACCGACGTCCGAAGCTTCAC
GTCTCGTCGCAGTGTGACTGACTGTTCCGACCGGACAGGAAGGACGGGGTCTCGCGAAGAACCTACCGGAAGTCAGTGGGCCACTAGTCCAACAAGCAAG
CCAGCGGCACTATACATGTCACCGCAAGTGTCCGTCAAAAAGCACGTTCCGATGCGTAAGAATCTGCGGTACGCCGGCAAACGCGTCATCATGGCGTTGC
GAGTGAAGAGTGCAATAATACCGGACACTGAAAAGAGGGAGCTGATGCGTCTGTTGCTCCGGAAGTACACCAACACACCTTCATCCACGACAACATAACA
ATTCATGCTCTAAATATCCCACCTGCAAACTATTTCCCCCTCAATAACAACCACAGTAACAACCACATTGAGACGTGTTTTCGCTTTCGTGAAGCCAGGA
GATTTATTGATTAAATACTCCCGTCTCGCTTTCCCACGAGGTTAGCAACAGCTTAGTTGGAAGCCTCGCGACGGTAGCCGTCCTGGCCACCGCGACGGAA
CTCGGGGTTGAAGTCGCCCGACGGGCCAACACCCTTCTCCTTGTCGAAGCGGCCACGGCCGAAGCCGCCAGCGGACGGGGCCTGCGGGCGCGTGGGACGA
GCAGCCTGCTTCTTGAGCGTGGCCGGCACGATCTCCGCGGGCAGGTGCAGGTACGAGCGCAGGTACTCGATGCCCTCGTTCGTGAGGTACCAGTAGAACC
ACTGCCAGTTGAAGGTCTCCTTGACGTAGCCGCGCGACTTGAGCGACTGCATGAGCTTGATGACCTGGAGGTTGGGCACGTCCACGGCCTCGTGCTTGGG
CAGCGAGAAGTCCTTCTTGGCGACCATCACGCCCTCCTTGAAGAGGTACGAGTACACAGCGATACGGTTCGTCTTGGGGACCAACATGGTGACAGGTGGA
TGTCTAGAAAGCTTGCCGGCGAGTGCGGATCTTCACGGGAAATAAGCGGCGAGGTTTGCAGGAAAACCAGAATACTCGGCCGTCCACCGCCATGAGCCCC
AGCCAGCCAACCAATGCGTGGGCTGTTCCCGCTACACAATATTGTGTATATTACGTAAAAAGTGTAATTACTCCCTTTAGCGTTTTAGCCAATCGCGAAG
CGGAAGGTCTCAAGTGTCGCCGATCGCGGTGTTAAACGTCTTGCGGTTGATTCGCAACACGCAGCAGTCAACCACCAATGCCTCTGGACCCGGCGGTGCA
CTCCGTGTTGGTGGACTTGGCCGCCGGCACCGTCGGCGGATGCGCCGGCGTCATTGTGGGGCAGCCGTTCGACACAGTGCGTGTGCCATTGCAGTGACCG
TCTGTCTAGCGCCAGTATCTGACGCCTGTGTCATTCGTGTTGGCAGGTCAAAGTTCGGCTCCAGATTCAGAGCAAATTCTACAATGGCGCCTTGGACTGT
ACCCGCAAGACAGTGCGTGGAAGTTTTTTTGTAGTACAAGGTGGCGGTGGCATAACATTGTACGTTGATTGCGTTTTTTTTTAATTTGCAGCTTCAGCAT
GAAGGCTTCCAGGGCTTCTTCAAGGGGATGACGTCGCCACTGATTGGCAGCGCTGCCACGAACGCCGTCATGTTTGCTGTCTATGAGCGCACACTCAAGA
TGATCGACGACACGCCGGACAAACCGTCGCTCACTTCTGTGTTTTACGCCGGAGCTATCGGCGGCTTCTGGCAGACAGTTCCGTTAGCACCCGCGGAGCT
CATCAAGTGCAGGCTGCAGGTACAGGACGGACGTAGAAGCAGCCAGTACCGAGGACCGATGGACTGCATCCGCCATATTATCAGGTGCAGGGGCGTCTCC
GGGCTTTTCCTCGGTTTCACATGCACGCAGTGGCGTGAGGTGCCGTCGTTCGCCGTCTACTTTTGGCTGTATGAATACACCAAGCGCATGATGCTCGACA
AGGGTATCAACGACACTACGTCCATGCTGACGGCCGGCGGTGTTGCAGGTGTTGCCTCCTGGGTTGTTTCCTACCCCATGGACGGTACGTTCATCCTCTT
GTTTTCAGCAAGTCGGCATTGTGTGTGGTGATTAACGTTGCTGTGTTGCTTTGCTCCGAGTAGTGATCAAGTCTGCGATCCAGACGCTGCCCGTCAACCA
CAAGCCAGGCGAGCACAAGATAATGCACCAGGCTCGTGTGCTATATCGTATGGGCGGCTGGCGAATCTTCTTCAGCGGTCTGGGCACTGCCTGCGTTCGA
GCGTTCCCATGCAACGCCGTGACGTTCTACGCCTACGAGAAGACCTCCGAACTGCTCAAGCAGGCCTCTCGAGACTAAAGCAGCAACGACGTCCTAGAAA
CCACACGTTACCATCTACATAGATCCCTCTTCAACATAGAACTTCAACTAATCACGTTTTATCTAGATCTAATTTTCAGGTTGAATCACGTTTGATTCCC
GGCGGAATCACAAGTCGATCTTACGTTCCTGCCTCATGTTGGCCTCCCTCTTGCGTCTGCGCATGGCGTCCCCAAGCGCTGCTGTGGTTCATCGTCGCTT
CGCATCCAAGAACAACCGTGAGCACATTGCGGACTGGATGGCGGGGCCGCCGCAGCCGCTGGACGTGGCCTCCACCAAGTTTGACACACTCTCACTTGCC
TTCGCCGACGATGACGCCGCCTCTGGAGTGCTGCACTTGAAGCTGAACCGCCCGAAGGTCGTGAACGCCATGAACATGCAGATGTGGGTGGAGCTGACCC
GAGCCTTTGAGCTCGTGGAGCTGGATCCGAGTGTCAGGGCCGTCGTGGTCTCCGGGGAAGGCCGCGGCTTCACCAGCGGCATGGACCTGGACG