Description :
From Genome Similarity Track
Location :
Scaffold_1:652838- 654181
Transcript NameFunction/comments
Physo_322267predicted protein
Physo_322268Hypothetical protein

Sequence
1343 bases(100 bases per row)
TTTTCAAATACTCATCGATGCGAAGAGGCTTCTTCTCCAGTGCTCCCTCGTTGCCTTCCTTCGCGTCCCCCAGTTTCGCGCTCAACTGAGTGAAGACGCT
GTCGTCCACGAATGCGGCTATCTCCTCGACTCCAGGCTGGAGATCCGACTGGCTCGCCATGTAGTGTTGCGGTTTGGCGACTTCTCTTTAATGTAGACCA
CATATTCGCTTTAATTGGACATAATCACTATGTAGTTTCTGTTTTTATTGGACAAAAGTATTTAGGCGCACATCTCGCCAGGTTTATTATAATAACACAT
ATTGTACTTTTTGGCACTTCAGACTGTATTTGTGCTTTGCAATGATTTTGGCAATATGAGGCGAGATTTGCTGTATTATTACGACCACCTGCTAGATTTA
CGATAAATCGAGGTGCATAAATGGGTGGAGGCCTAGAATTACGCTAAAAGCGCCACAATTGCACTTTCAAAAGTGCAATTGTGGCTGTGCAGCTGCAATT
CTGTCGGTTTTTATCCACAAGCACCTACACACACGGCAATTATGCATAAGAGGGTGGATGTGCTGGGGATCATGGACGGTGGTGTACTGGGCCAATGCAT
GGCTGCTGACAGGCCCTCCCGAGTCGATATATATATGAGGAGGTGGATTTATGCATAATTTTAGCAGGCCGTGTATCTTCTTTCACACATATTTAGGAGC
AGGCTTTGCCATATTTAGCGTCTAAAATGGTCGGCAAAATAACTGCAAAGCACAATAACTCGTACGACTTATCGAGCACGACTATAAATCGTACTCGAGT
ACGAATTGCTGTAAGTCGTGGATGGTCAATCACTTGTGTCGAGCATTCGTAAGACAGTTTGACGACAAATCAAATGTAGCAATTTCATTGGTTAATATTG
TATTATGTAGTTTTGAGTGTTGCTGCATCTCGGCTCGTAAATTGGACTGATTCATCTGTGTGCGCATTTTGCCCCCTTTACTAGAGGCAGCGCACTTGAA
AAATGTCCGGGCTTTTGATCCTGACGCCATGCACTAACCTCCTGCTAGAAGATTTAAATATACTTGCCAGGAATGGAATGTAAGGACATCATAGCACAGT
TATCATACGACCGTTTGTTCCCGTAGTGGAGCAATGTTTCTTCGCTTTACTGGGGTGAACGACTGTTGTCGTTCACCCCACCACGCCAACTCTCCTTTCT
ACAGTAAAGTACTAACACTACATAGAAGATGGAGATTCGGATAGAGGGCGCATACGCAAACCAGTCTACGCTGTAGCATCGACAAAAAGCGTGGCTGCAG
GCAGTGGCTTAGTTGCAGGAGATACCGAGTAACTCGCCGATGC