Description :
From Genome Similarity Track
Location :
scaffold_10:652808- 655178
Sequence
2370 bases(100 bases per row)
CGCTCCACATCAACCAGTATTATAAAAGACGGACCTGGCGATCCGGAAGGTGTGTCACTCCTACACGGTGTCGCACTGCGCACTACCGGTAGTGCCAATT
ATTAAGGTAGGGTGCTCTAGGTGTCGTGCTGTCGTATATCGATGGTGCACTAATAACGCCATTCCAGCAAACGACACGAGCATTCCCATCTTGCACCTCC
ATCACACGCGCTTATCTCTAAACAACTGGGATGATAAATGAGATGTGGGGACTTCGTGTCTATTATACTAGTACTACTGTAATAGTAAACAATACTGTAG
ACAGTGTCGACAGTATAGTATACTAGTATTGATCTGTTGTACTGAACATATACAGTACTAGGATATTGTCATTGATCTGCTGTACACGTGCTAGTACCGG
GAATACCAAGACTGGATATAATCTGCTGTACATATGGTACAGTAACAGACCAATAACTCTATGGCAGTTATTAATCTGTTATACTAGTATTACCGTTAAG
CAGTTGAATATCCAAACCACGACGACCTTCTGATTCCAAACCCACTGCATATTTCCCCTCTGACAGCATTTTATTATTGAGAGGAGGCATTGCAATTAAG
ACCTCGCCGTTTAGAACGGTACACTCGGACTTATGACGGTCATTGATACGTTGCTCACCACTCTCGGGCGATTCGCGCGCAGTTTTTACTTGTACGATTT
TGTCAAAATATAACGAATAATACTGTATAAAGAACATATCGCTTAAATTCTAAATAAATACGAAACCTATCATTTCCCTGTTACTTTTTGTTTAATCTCC
CATCGCAGCTTACGACGACAGCAATGCATAGTGAGTGCATTGTACAAGTCTCTAGGCCACCAGCAGGTGGCCTTGAGACTTTCTACTGCAGAGGCACAGC
ACATCTGTAGATCCAATCTGGCTTTGCTGTTCGCGGGCTTCCGCATGTTCCGGTACATGGAGTTCATTTCGCATCTCGCTCTCAAGGACTCAAGTACTCC
CCCCCTCAACAACTCCAAGCAGCCATGCGTCTAAGCGTCGTTTCTTTAGCGGTTGCGTTTGTAGTCCTTTCCAACTGTGATGCTGCTTCAGTAGACCAGA
CCAAGATCTCTAAGATGGCAACGGTGGGCAAGATCGACGCCGAGGGCCGTGTCCTTGCTGACAATCGATCGTTGCGAGGATATAAGCGGACCGAGGCCGA
AGATGAGGACAGAGCAATCAGTGCCTCGCTTGACGACGTCATTCTAAAGCTCAACGCGGGAAAATCCTCCTTGCAGCACGTGGTTGATGTGAAAGCACTG
GACAAAGCGGTGAAGAAAGCGTTCAAGCAAATAAGTGCCCAGAAAAAATCCTATCTGGAGAAGGTTTTCACCGAGTCGAATTTGGACAAGATGCTGACGA
ACGAAAAGCACGCCGAGGCGACGTTTTTGGAGTGGTATGCGCTTGGCCTCACAGGCAAAAGGATCACGAGTAGCCTCGCAGGTGTGGGCGCACACTACGG
TACCCTGTTCGCTCAGTATACCACCTTCATTAACCGGTTTAAAGGAGTTGCGTAGGAATCTCCTCCGCGCTATTCTTCAGTAATGCACTCCAATACACTC
TTCGTCTAACAGTACTGGACAACGAAAGAATAAAAAAGTTGATGGCAAAGACACCCTTAAATAAACGTGGTCAGAGCAATTTATATCTGGATAAGGAGCG
TACGCCAACAAGAATCTTTTGGAATGATACGCGCTCGACCTCACAAACAAAAAATGCTTTGGAAGTCCTACTGTAGTGGATGCCAGATATTTCATCTTGG
TGTCACCACGCCTGCGGACAAGCTATCCCAGCATGTGATCACAGATGACCCAGATGTGTCTGACGGTCGCCAGCCTCAGGCAATGGGTCGCCATATTTTA
ACCGGTCTGGCTGTCAGTGCCAGATCCGGCCTACATGAGGAACTTAGTATGTCGAAGTGCATGTTGCATCCAGGACTCTGTCCACTACATTCCGGCTCTT
ACTTCGTCAGCTCCATGGGGACGCCCTTGGATCAAGCTGACCGAAGTAGACCAGAGCGAAGGGCTGGTTAGCATCAGACCCGGACCTCACTTCTCAACTT
TCCATCTAGCTACCAATCCATCAATACACTCGGCTTAGTTCCGTGCGGGGTGGCTCCCGCATCGTCGTGTGTTTACAGATCGGTACTTCTACCCGGGAAA
CACTACACCTACATGAGTATGGGGCGAATTCCGGTACCAACGCTGCAATTAAAATTAAGAGGAACTGAGCCAACGGAGCAGGTGCCGCCCGAAACGGTTG
CTGCTGGCATTCTCTTGGTTGTCACGAGTCGTGGCCGCCGCTTTTTAAAAAAAAAGTAAACGAGGATTTT