Description :
From Genome Similarity Track
Location :
Scaffold_138:6528- 11433
Sequence
4905 bases(100 bases per row)
GATGCACTATTCCTTCATATACAAAGGCATGTACATGCCATATAGATTCTGGGGGTGATATGAGTGACGTCATCTGGATGATGTCCGACAAATATAGAAT
CGTCCATCGGAAACTTGCATCATCTTGGCATGTCAGTAGGCCTGTTACTCGCCCCCATGCTAGTTTACGCTAGCAGGGAAACAAACGTCGGAGTTTCACT
CATTCATTGACTGCTCCGCAATCAAGTGTGACGGTCCATTGGTGTGCACTTCCGTGATCGGATATGGTCCTGAAGCCGCTGCTCAGTGCTTGGTTTGTGA
TCCTTGGCGGCAATTCGCATCATGCAATGATCACCGACGTTGTAGAAATGTTCCAAACGAGATTGATCTTGACGATCATTTTCTCGCAAAATTGTGTCAA
ACCGCCGCTTGGTAAGAATGTTCCAGTTAGCTTCATATAGCTGTCGGTTTATCAGATCTTGTCCGAAAATTAAATGCGCTGGAGTTGTACCGAGAATGCT
GTGGTAGCTTGCTCGCACTGCAAACGCCGCGTACTGAATCACCTTTCGCCAATCTGCACCATCGTGACAACGGACACAATTGTTCAGTGTTAGCTGAACG
CGCTCGCATACAGCATTTGCTTGGGGGTCTTCGCTGATATTGGTCTTGCCTTTATTGCGTAGCTGTTAAGCATTTTAATAATTCTCGTGTGCTGAATTCG
TTCCCGCGGTCGAACACGACGGTTTTTGGTCTTGAATATCTACATAGCCATGTCGCGTCAAAATTCTGGTCTGATGTCAGCCCTTGTTGTCCGACTGAAT
AGAAACTTCGAGCCACCGCGTTGCTTCGTCAACCACGGTCAGTGCATAACTACGATCGTTGCCATATGGTCCCATCGTGTCAACATGTACCACATCAAAA
TGGTTGATGGTTTGAAGGTCACGAGGAGGTAAATTTACCGTATTTTTGAGGGCCACCATGCAGCTTGGCACGCTTGCAGATGGCACATGCTCGGAAAAAA
TCCACAATACCGCGTTCAATGCCTGACCAGTAGAAAGTTAGTCGCGTTGCATAATATTTTCTTTTTGCTCTAGGGTGACAGAGATTGGCGTGGTACCATT
CCAAGATTTCGTCTCGCAAGCCCGTTGGAATGACGACTCGTTTTTGGTAGGTCATCAAGCGAGCTCCCATGACATTCATGATCTTGTAATCAGGGTCTCT
TGTGGCTTGGACGCAGCGATGAGCTAATGCTGCGTCCAAGCCACAAGCGACTCTATCTTATGTTGCTGAGAACATAAAATTGTATAAAAAGGCATATGAA
GTCACTCGCCTCTGATCTTCATGATAAGATGAGGATTCCGCTGAGCTAGTATTGATGTTTGTAATTTGAATACCACGCAAGAGAAGATAACTGTATCCTG
AAGTGCAGAGTATGTCTGTTGATACGGTGTGTACCGTAGATCGAGTATCAGCATGCACCAAGGCGTTTTGTTCAGACAACAAACATCGATCTTTCTTAAC
TTAATATGTGATTGTCTTTGTTAAGTACATTACAGTCATACGATACAGTGTTCTAACGATCCAAAATGTCCGTCGAGAGCCGGCATACACCCGTTGCTGC
TGTGTGGGCTATATAGGTTAGATGCCGACTAATGCACTCCGTGATAGGGTGCCAAATAAGTTGTCCTAGTCTCCAGTCTTAAATATTTTACCTCTGTGCT
TGCGTTATCTTGCCAATATTATAAACGCAGGCCACATGAGAGGTTATCACCTGCCATTCGGGCGGAATTCGGGTTGCTGTGGATTGGTTCACTCGAACAC
TTGCTCTCGTATTTATCGCTCGTTTCGCCGGTGCATCAGCCATTCATTTGAAATGTCGCAAATGATGCGAGAAGTGGTATCTTGTACGCGATCCGCCATA
GCTACACATTAGCGGAAGCATCTTTGAGATGGTGCGCCTTGGGCGGATCCTGGTTGCCCAACTATCTTATAATCAGATTACTATCTTTGATCGCGCAAAT
GGAGCGGGATATTTTGTTCTGTAGAGTTCTGAAAGCCAAATATAATCCCCTTGTATTCAGCCGCATCATTAGTGGTGAATGCGCTTATAAGTGACACAAT
TTCCATCCAGTAAATGGTGAGATATGCCGCTGTTTAGCCCCACGACACATCAAATGACCCAGCTCCTCCTGTTCCGGTATTATTACTTGCGCCTCCATCA
AAGAATAGTGCATATGTGTCACCCGCTCTAGCTCTTATCTGGGAAGTTGAACACCCCTCGGTTGCAGCCGTTGATGTCACGTGAGCAATATTTACCGCTG
CCGGACATACTTTTATGTGGGCGCTAAAAAATTGTACCGCCTGACATCTTCGGGCAGTAATCATCCATGAATCTATCCTTCCATATCCCACGTGCCAAGG
GTGCGTAGCTTCAGCCGATAAATGATCAGTAAGGCCCAAAATATCCCCCTCCAAACCAGATATTATCTTTACAGTCCATTGTGGCCAAAGCACTACCTAC
GGTACTATCATCGTCCATCCACGTTCGGCCCTGATGGGCGATTTCTTGTAAGACGTGATGTCGTTTATACGCACTCATGCCTCTTTAAAAATTTCACGTC
TCCTGGATGTGTCATCTTGATGTGCACAGAAACTTTCGATGCATCCTAGGACAGGTTGTAGGGAGAGGATGACGATCCGATACGCATCTCCTGTCCAAGA
AAGTATAGCTTCTATAGTCTCTAAGTATGACTTCACCACCAACGTGCGCACCTGCGAGGTATATCCTGTATCTACTGTCACTGTCCAGCTTCATCTATCG
TATGTCCAGCGGTTAGGTAAAATGGATGGTAGGCTGGATCAGTTGAGATGTCGATCGAGGCCGGGTGTCCTGGATCTAACACCATACCCAAATAATTTCG
CAATAAGCGGTACTAGAAGATCTCGTATTGCTATTCATCTCCAATCAGTCGGGTATTGTAAATAAATTAGGGTCAGGCAAGGTTTATACCAGCGGAGGAT
GTTGGCTAGGACAACGATTTTGTATGTAATGTGGCTAATTCTGTCCAGGTATAGCCCGAGCCTTCCGCCTTTATTAGAACATAGTGGGAGAGATCCACGA
GTGGGTACCATACTTGGTGAAGCTTATCATAATGAGTTTCTATATGACTTCGTATATCTTGCAGACAATTTTAAAGTAGTGGAGTTAAATTAATTGTACT
GCAGCCCAGTTTTTGTTGCACCAGTTCCCGAGCCCCCCGACCGGGTACGCATGAAGGTTACATTCCTTCAGGATCGGGTCACTGCTAATCACTTGGTGTA
AGCCCAACACCGCTTCCCAACATACATAGGTTTTCCCTGGTCAGATCCGCGTGGAGTTGTCCTGTATTCCCGAGTGTAACCCACGATGTTATAGCTTCGC
TAACGGTATCGCCAGTACGGAGACATTCGCTAGGCGCTTATACTGTGCGGTAGCCGCACCCAACTTTGTTATTGTCACAGCTGCCAGATCCAGCTGTTAG
GCAAGTAATTATGGAATAGCCGTTCGTCCCTCCGATCGAAGCAGAAAAGTGACCGTTGGTAAGCCACGTCATGCACGTTCTGTCGAGAGTGTGAAAGACG
CCATGCAAAAATGTAGTTCTTTATGTGCTGCTGCATGATCACGACGGCTGGAGTCTGTGGCCAGATGTGGATACGAAAAAAAAAAATCAAGCTTCGGTGC
GATGACCGCCGTAGATGTACAAGCCCGTTGATTCATTTTCATCAATATATGTCTTGCTAGTCTCCGAAAGACCTGCAAATGATCCACTACATTCGTTTAA
TATCTTTTGGATCCATCGGTACTGCCATACTGGAAACCTGTATAATGGCTGTATTTACACATGGGTTGGAGAGTGACTGGCCACGTCTATCTAACCGCAG
CAAGAAATTTGTCCTTGTGCGTTGCAATAGCGGCCATTTCTTACGTAAGCTTGAGATCGGAAGCTATCTCAAATGCGTCGAAGATCTCAAGCGCGGTGTC
TTTTCCCGCCGTATTATGTTAAAAAAGATCGCCGTATAATCGGCGTATCCTGCCACCAGTAGATCCACTTGGAACCAAACGCTGTTAAGACGTATCCCTG
TAAGGCTTTTCGGGCCAGCTCGCGGGTGCCAGAGGAGTTCGAGCGCTAGAATGAACAGGAGCGGATAGAAAGGTCATCCCTGCCTAATCCCTCTTCTTCA
TTAGTCAATATATTGGCCTTGGTGCCTGTAGCTGAGCTAATCTTACTCATTTGTCGGAGGAATACTTTTAAACTCATAGAGTCTCTCAGCGTATAAAACT
CAACGAGTGAAAACTTAAAGGGTCTGAAGTTTTTACAGACTTAATGAGACTTAACTCTAGGTATTTAAACAAGCTCGCAAGCTTCTAGTCCTGGTTCAGG
GGACTCATGACGCCAAGAAATTACGTGGAACGAATGCCCAAGAGTACTAGCCTTAATACAGGCTCTTAACTAATACGACCAGAAACGTCTTAGAAAGACA
CGTGTCTGAAACCGATTTAAAAGGGGAACTTATTATTTATTTACTGATTTATAGCGATAATAAACATCATCCACATATTTAACCTAAACCTATATTACCT
AATCTAGGAATCCTAATATTGGTCCTTCTTGTGCTATCACACCAGAACAACGACGATACATTTTACGATAAATACCAGCTAACCGTAATCGATAAGCTTT
ACCGTATTACCGCTTAACGTATTGAGTACAATAATAAGCCTATAAGTGTCACTGATCTCATTATGTGTCGATCACACGGCGCCATACCAGTTATACCAAC
CATTTGTATGACCCCGTTACAGTGCCAGTATGAAGCATTAAGATCACCCCCTAAGTGTGGGGGGTACACATGTCTTCGAAGTGTGGCGTAGCAAAATTCT
CTATC