Description :
From Genome Similarity Track
Location :
Scaffold_196:6524- 8137
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_1580760S ribosomal protein L27

Sequence
1613 bases(100 bases per row)
ACACAACAACCTTCCCGTTCTTGACACTACAAGAGCCATGAGCTTCGTCTGTACATTGCAGTGGCGCAATGGCAGCAAGGACGACGACGACAACAGCGAC
GACAGCAAGATATGGCGTTGGGTGGCAGACTTCGCCGCCACATCGGCGCATGCAGCGCACACCTAGAGAATCGCGCGACCGTCGTCTTGCTCATGTTGAC
GCCTCATCCTTGTCGTCATCGTCATTGTCGTCGTCGTCGTCGCATGCCATTGCTGTAGGTGGTAGTTCACTTACATGCCCATGTTAGCTCTTTTAATGTC
AGAGAGTGTTCCCGTTTAAACTAAGCCGGCCGACGAGACACCGGCGCCGACGAACGACTTGGTAACCAATCAACCACACGGACCAATCACCGCGTGGCAA
AATTATCGAAAGAGAGAGGATTTACCTCTCAGAACGCATAATCGCGAGCCGGCTATCGACCAGTCAGCGTATTTGAGTGGAGGGCGGTCCGGCCCGAATT
TTGACCAATGAGAACGACGAACCGTAATCCCTACTTGGATTGGCTATTGCCAAGGCGACGCGCCGGCCATGCTGGAGGCAAAGGACATAAGGCTCTGCAT
GGCAGTGAAGCCCGGCGTGGCGCTGCATCTGCCTGGCTCTGGCAGTGGCAATGAGGCGCTTGGCGCCATCTCGACGTGGCCATCGTGTGTATTACGATGT
GCTGGCTGCCAGTGCCAAGGCCGTGGCCCGCGGATCTGAAGTACTGGAGGCACCAGGTTGGTCAGTAGATGCGCATTTTCAAGACTCTGCTGTGAACCAG
AGAAGCCTTGCGACTGCTAGCGTTACCTATATCCTTGGAGACGTCCTGGCGACGAACGACGAACGGGCTGGTTCAAGGACGTGCAGGCAACATGATGATG
ATGATGATGATGTATGGTGGTGGTTGAGTCACGAGTATTTGACGTTGGCGATGGGAGTTGGCAGTGTACGGAAGAGTGCAACGAGGTGAGAGATGTCGAG
AAAGGAGTTGCGTCTGGTGGCCAATGTGGATGCTTCATCGTCGTGGCGGCGCGGTCAAGAGATGCGTTTCGTGTGGACCGAGACACACGAAGGGCTACGC
ACTGGACAAGCCACCGCCTTGGATGACACCAGCTCTGCGAGTCGTAGTGCGGTTGTGATGCAGTTCTTAGCAATTCGATTGCGATGTACGTGTGCGTGTG
TGCGCTTCAACGTCCGTCGCACCCATTGGCGTAGCAGACGCGAGGGCCTGCACATTCTGCAAGGCTGTGTCGGCGAGCAATCTACCCGCGAGCTCAGCGC
AGCAACGGAAAAGCCATACTGGTATTCGCTGCGTTGTCCATGCAAGTCGATGTCCATGGAGACGAGGAATGGCATCCGTGCCAAGGAGGCGTCATGTAGC
TTGCCACTTCAGGCTCTGGACAGAGTGGCGCTACAATGCATACATTCCTAGCATCGCCGCCGATGCACGCACTCGATCCATGGAAGCTACCGCGATCATG
CACGCGAGCCTTCGCGTCCTGCGTGAACCCGGCCGTCATCCATCACGCTTCCTGGGTCCCGTCGCCCGGCACCGCGTCGATGACCGCATTGGACGTCTGC
TCACATGCCATGC