Description :
From Genome Similarity Track
Location :
contig_91:65217- 67328
Transcript NameFunction/comments
g12540.t1hypothetical protein

Sequence
2111 bases(100 bases per row)
TCGGGACTCTTGTCTACGACATCATGAGTGTCAACCAACTCCGACACGCCGATGTCCAGCACGTTGACCGTCTCGGTCCAGTGCTCGCGCCAATAGCGCT
TTTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAAGCTTCACCAGGAGGCAACCGCGTAGCGCCTAAGGTCTTAGACCTCCAATCAATCCATGGCTC
ATGGCGTTCCAGCCATGCCATGCCCAGGATGAGATCATATCTCGAATCCAGGTCAAGGACCAGACAGCGTTCAACGCTATCGAAGTCCAGAAACTTCACG
CCAAGGTTCACAGGAACCTTGGGCACCGTAACGCGGGTTCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGCTACCAGCGCCTCGGCATACT
GCCGACTTCCTTCCATCGTGGAGCGTCGAGCATAATTGCCCGACGCTCCCGAATCGATCAATATCGTCCACGGCTTATCAAAGCCCTTCACGGTCGCTTC
AACGACCAGCAAGCCCGGCTTGCATACACGTTCCGTGTTAAAGAGCACGGTGCTCTTCGGGGCTAAGCCCTGCTGACCTCCTTGCTGAGGCTCAACAGAA
CTTAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGAGCGTTGACGTTTCCCCGCCACGAACCAGGTTTCTGGTAAGAAGCTGGGCTTCGGCTCGCCGG
AGCCTGGCGCTGCTTACGCAGCGGGCACCCTGGTCGCAGGTGCTGGGTGCTCCCACACACGAAGCACCGGCGGATGCCGATGCGCTGCTCGGCAGCAAGA
AGCTCAGCTTCTTCGTCTTCAGCATGGCTGAGATCCATCGGCTCGGGCCCACCCGAGGAGCCGGCGGCTCCGGATGAGTTCGTCTGCGACGTTCCCCACC
CGGCTCGGGCCGACTTAAAGTTGAACTCGGCGTTCAACGCCACGCTCACTGCCTCTTCAAAAGAGGTGGGGTGAACTCGGAATACTTCCGTTCTGGCCAC
GCCAGTGCGGAGGCCTTCCATGAAGATGGTCACCGTGACCGCCTCCGGAAGAGGGTCCGCAGCCATACCGGCAATAAGCGTTCGTAACTCTTGGACGAAG
TCCACCAACTCCTTCTTTCCTTGGCGGGTAGCCAGGAAGCGTGATCGCACGCGATAGGCCTGGTTAGGCGGCGAGAACACTCGCGACAGCTGAAGCTTCA
GCTGCTCCCAGGATGGGAACGCGCTGTCCACCGACGTGCCACACGTTAGGGCCCACTCCCGGGCCCGGCCATCCAGCTTGGACACGGCCAGCGCCACGCG
TTGTTGCTCCGTCTGGAGTATGGCGGACGCCATGGCCATCTCGACCTCTCTAATCCAGAGCAGGAGATTCTCTCCTTCCTTGCCCTCAAAGGTCTTCACG
CTCACCATGAGCGGCTTAGCTCGTGGAGCTCCATCCGATGCCGGCTTGGGCGTTGTAGACGCTGTCACAGCCGTCATCTTCTGTTGTAGATGTTCCAACA
GAGCATTCTCATAACTCGAGAACGCCTCCAGACGCGCATTAATCGCGTCGGGGCCTTGCGAAGCAAGATGAGCCACACCTTCCGGGCCCAACAAGGACAT
CAGCTTTTTAAGCCCGTCCTGTTGGTTTGGGGGTAAGTGGGCAAATTGCTCCATCCTCACAGAGGGACAGTCGTAAGACTCAGGTGTAGGATTGACTACG
AGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTGCGTCAGAGGAAGACGTAGACTCTCAGAGTCTTAGTTCGGTTGTAAACCTTGGTTCTATACCAGAA
CCACGTACAGTCTGTAGATATGCGATCTACAGACTCCTAGAGTTATTAATACCTTAAATAAGGCCAATAGACACTAGACTTCAAAACGTGAACTGATTTT
TATTGTTGTTATTCGCGGCAGGGCCGCCAGTGGGGTAAATGTATAACACTCACTATCTACCATAGTGGAGCCTAGTAATATGCATGACGGGTGGCTGTGA
GGCCACCAACCTAAGTCTCGTGTACACACACCAACTTGGGTGTGCACACCATTTGTGTGAAACACACTATTCGTGTACGATACACTAACGGGTACGTGTA
ACCCCGTTACA