Description :
From Genome Similarity Track
Location :
Scaffold_58:65208- 69156
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014092Similar to Nova1: RNA-binding protein Nova-1 (Mus musculus)
Pytul_DAOMBR144PYU1_G014091Similar to CCDC88A: Girdin (Homo sapiens)
Pytul_DAOMBR144PYU1_G014090Protein of unknown function

Sequence
3948 bases(100 bases per row)
ACGACCTCGTGCTCCCACTCCCCGAGAGCTCCGTCACTAAGAGCATGGCAGTGGCTGTGTCGCGTCCGAATCCAAATCAAAAGCAAAAGTCTGTTGCTGC
TACTGTGAGTGACGCGCGCATTGGCTCGGTCACGTGGCTCTTGCCCGTGCAGGACGTCGGCAAGATCCTTGGCCAGCGTGGCGCGATCCTCAGCGCCATT
GCTCGAGACACCGGGACCAAGATCCACATCACACCTATCGCAGAGATGGCTCGTGGCAGCACGGAGCGCGCCGTGACGATCTCGGGGCCGCCCGACGGGG
TCGAGACTGCTCGTCAAGCTATCGAAGCGAAGGCAGGCGGCCGCCCTGAGGACCCAGGTTTCAATGGCAAGTGCGGACAGTACTTTGCGATCCCATACAC
GTCGGCCGGAGCGCTCATTGGCCTTCAAGGCACTACCGTCAAGCAGATCGCGGAGAAAACCGGCGCGCGGCTGCAGATTCCGTCGTCTGAGGACCTGCCG
CTCGGCATTCTGAACCGCACGCTGCATATCCAGGGCAACAAGAAACAGGTCGAGGCAGCGTACGCGATCGCGTGCCGCAAGGTGCGCAAGGAGCTGCAAG
AGCAGGCGATGGAGGTGCGCGAAATCGTGCCGGACATCACGATCAAGATTCTGCTGCCGACCCGCATCGCGGGGTTCCTCTTAGAGCAGCATGGACGCTT
GATCCGCGAGATCTCGGAGAAATCTGGCGCGCACGCGCATTTCCTGCCCCCGCACGACGACGACATGCGTTTGTGCGCGATCAAGGGCGAGATGTCGCGC
GTGTTCCGCGCCGAGCGCCTCATTCTCCAATTCATCGCGGGCGACGCGATCGCGACGAAGCGCAGTGGCGGTGGCGACACTGTCGTCTTGTCGGTCCCCC
GTGAACGCAAACAGAGCAAACGCCGGTCGCGCGAGGACTCGGATGATGACTTTGACGATGATGACGACATGGAGGAGTTGAGCTTTCCTCCCAGAAAGGT
GAGAGGAACGATAGTACGACCCACGAACGGCGCCACGAAGCGAATGCGTTTGCAAGGCCGGACGACCAAAATGAATATTGCAACAGACACCCGTCGAGTG
AAACTGGTCCCGACCATGGCACGAGGCACAAAACAGAACGGAAGAGCGAACGGAAAGCCGAATGGGAACAGTGGTAGTTACCTGCGCGGCGGAGACGCGC
GTGTCCCGAAAGTGGATATTCTCGGCAGGTTGCAAGCCCCGCTCCAGTCCTCGCGACACAGCAACAGCGGCACGACTCAGAGTACCAACAAGCGACAACG
AAGATAAAACAGTGTTTGTTGTTTGCTATTCTACCAAGTTATCGACGCGATAGAATCCCCGCCGCCGTCGCGCACGCAATGAACGAGAGACCAAAGTACA
ATGGCGCGGTGGGCGTCCCCCCTACTGCCTCCGCGAGCGATGAGCTCTCCAGAACACTGGCATCAGTGATCGTCGATCGCCGCATCCGCTCTCCTGCATG
TGCGCTCTGAATAGGATCCGCTGTTGGCCTCATGGCTGTGTACGTGTAGCGCCGCCGTCGCCGCGCTGCGACTTGGTGGAGGAACGTCGGGTTGCTGGTG
TTGTGCTGTGTTGTACCCATAGGAGCTGCCAAGTCCTCAGTCTGGGAATCAGAGCTGTCGGTGTCCGATTGAGGCACGTTCTGGTCGAGTGGTGGCTCAG
TTTGCTTCGCAACCATGCCTTGAACACCATGCGATTCACGGTCCTGTTCTTGTTGGAAGGTTTTGTCGGCTGTTCGCTCCACTCCATCGTACGTTTTCGC
TCGCTCGCGCTGCTGCTGCTGGTTCTGGCGTGAACGATACGCTTTGTCGGCGGCCAGAAGATCTGCGCACGTGGTTGTCGTCATGGACTTTCGGCGTCGA
ACGTACTGCTCGACGACTTGAGCTGGCCCCGTTGGCGACTTGTTGTGGCGGCGAAGCACTCGGTTTTCCATTTTGAGTTCTGCCAGCGCGTGCTGCGCTT
CTTCGAGCAACTGCTCGAGGTCTCTCGTGTACTGCTGCAGACGCACGTTCTCTTCACTGCTGTCGTCGTTGGGACACTTGTGCGTTTCCCATTGCTTTTT
CGAAGCTGCAAGCGCCTTTGCAAGCGTCTGGGTTTCCGCTTCCAGCCTCACAACTCGGTTTTCCAGCACTTGGGCCGCCGTGCTCGCCGCTCGTCTCTCG
TTGTAAAGTGAGTCAATGAGCGCATCCCGATCTTCCAGTTTCTGGACCAGCGCGCTGTTGTCACTCTCGAGGCGTCGTGCAGTAACCCGAAGGTTGTCAC
GTGCAGCGATGGCGTCGTTGTGGTCGGCTTGAAGATGTGTAATCTGGGCGGTCAAGAATACCACGTCCTCGTTGGCACGGCCGTGCTTAATCAGCAAGTG
ATCCAACTTTGTCTGCCCATGCAACCGCTCGTGCTGTAGCTTGCGGAACGCCGATCGCTCCTTGGTCTGCTGGTTTTCCAGCTCGAGGCACCTTCGTTTG
AACTCGTTGTTCTCCTCAACGATCGCATTCCAGTTTACTGCCGTGTGCTGACAATTTTTGCTCGATTCTCTTTCATTGAGCACCCCGTTTGCACGACAAG
GAGCCTCACGTTCGGTGCTGCACTGGGCTGCGTGGAATTGCATCAGCTCTCGCTCCATGGCGTCGCATTGCTGGTCCAAGCGGCGTCTCTCAACCTGCGC
GGCTTCGAGCTCCTGCTGGCACTTGTGCAACTGGTCGAGTACCACGTGAGTCTCCGCTCTCGCGTCGTCCAGTTGGTCCAAGAGCGCATTCCCCGCATTC
GCAGCGAGTCGGACATTGTCCTGCTCGCTTGTGAGTTCGAGAAGCGCCTGCGAGAGCGTGCGCTGCAGCACCAGCTCGCGGGTCGTGCTGTTTTGCGAAC
CTTGTGCGTCAGTAGAAGCTGGCTCCGCTTTCACTGCACTCTCGTTGTCGTCGTGCCCTGGGCTGTTGTTACTGATGTCATCGTCCTGGTTGTCGTCGTC
GTCCTCTTGGGCCTCGAGCATTCGCGAAATGAGCTCCGAGATGCTCGCGAGCAACTGACAGCGCTCGTCGTCGTCCGTGGATTCGTAGCCGTCGACTTGT
GGAAAGTTCCAGTCATCGCTCGTTGCACCACCAACCATGTCGCGGTCTTTCCTGCTCAAGCGCACGTCCGTGGCGTGTTCTTCTCCACTATACGCGCCAT
GAGGAAGCACGTCGCTCACTGGGGGATGCACCATCGCTGGCTGGTTGCTCTTGATGTACGAACTCGCAGTGGGGATTACGCGGCTCCTTTCGCTGTGCGG
TAGTTGTCGAAAAATAAAACAACACAAAACAGCTCAAGGACGCCGAGAAAAAGCTTGAAAACTCGCAACGGCTGAAGATCGCGCTGTGACTCGGCGTATT
AATAATAAGACACCGTTACGGTTGACGCCAAAGAAGAAGGGATTGTGACGACGACATTTGACGCATTTCCGTCATGTTGTGACTTGTTTTTGTTTCTAGT
GACAGATGCAAAAGAGACGCGCGTATCTGGTTTGACGAGATGCACAGTTGCTGCGCCTCTATGTCGCCACCGTCACCGGCATCTGGGCCGCACACAAAAG
CCGCCATCTTTACCACTGCAACACCGAAGGGATTCACTTTCTCCAGTTCCAGTATACATCAATGCGATGAGGTGCGGAAGCCAGCTATTTCTGTAAAAAA
AAAAAGGCACCAAGAACGCAACTTTTAAATAAAAACGAAAGAAACACGCGCTGGAGGAACGCAAAGCCGGGTATATGCGCAGCTTTTTGTGATTGCCAGA
CGTTTGCGGAAAAGAGCGCGAGAATGGCGCATCTGAGTAAGAAGACAGCGGGCGTCTAGTTTGTTTGGCATATTTGGCGCTCCATTCTCTTCATTGACGA
CTTTGACGACTGTCAGGTGAGCGTCATGGAGACGCGCGGCGCCGCCGG