Description :
From Genome Similarity Track
Location :
Scaffold_80:65186- 67016
Sequence
1830 bases(100 bases per row)
TACAATTCAGAGCCTTTGGATAGACTGCCTTGCTCAATAGGAGTATTGTCAGATTACAGCAAATGTCAGCCAGCCATATTTTCAATACTCACAAAGTACA
AATCTATCGCGCGACGGCAAGTTGATATTTACAGTTTATGACAATACACCGCATCCCCAACGTTGGATAAACACGGTCAAGACAGGACAGCCCTTGAACC
TTGCTGTCGGTCGAGATAATGTGTTGCCCGTTCGATCTTGCATACATTTCACTAGATTATACACATACCTATTTGCATGTGTGCTCTACTGCTGTTGTGG
AGAAATACGTAAAGCATGTATGGATTGTACAAGCCATTTGCTTGAAGTTGTCACTGCTTCCACTCCTTTGGAGTGTTATCTCGATGAAGAGCACCTCCGT
CAAATCTAATATGGACAGGGCCTAGTCGTTGATGCATATCCGGCTATCTACGCTTTCAGTAGGAGGTCTCACTGACCATATCGAATATATTTGAAGGATA
TATTAATCAGCAACCCTACAGGAAGGTCAAATTGTACTTTGTACAGGGGCTATTGGGAATACACTAGTGATAACGACAATCCTCCGAGCGCAATAAAGTC
ACTTTGCGGTTCTTTAACAGAAATCGTTACCTTTGTGGAGTCACTGAAATGCGATCACCGACCAAAATAAGGTGTAAGTCAATTATCGCATGGTGCTTCA
TCAGCATAATTCATATTTTCCTGGGGGGAACTCAATAATTGCTGTCAAAAAGTATTGATGTATTTTGGCAATACAGAGACTCTTGATCAGATTTTTGGGA
ACACCCAGCTGCACAGGGGTGTTAGGAGGCGATTCTTACCTAATCGACATGTCAGATCGGGTCCCGCGACCCTCTTTGACTCTACGAGATGTTCGGTATG
GCGCGAAGACCCTCGCCATTGTCTTCGCTAATTTTTAGGCGGTCACAGAGCGCGTTTGGCGACACTATGGCAGCGTTGCCGTCCAGTTGAGGCGAATTTA
GTGGGTACTGTGTTAAATATGCATCACGACACTATGGAAACAGCGCAACAGGGTTGTACATCAGCACAATACTGTGAAATTGTAGGGGTGCTTCCTAAGG
GAGAAATAAAAAATGCCCTATTTAAAACACGAAAAGAAAAATATGTCCCAGATAATTGTAAACAAAATTTTGCCCCAAAGCATTGATAAATAAGTAAATG
CCTCGCGTCCTAGTATAATCATGTTAATGTGGCACACATACATCGGCATTGTGTATCGATGAAGGACTTAATCTAATATAATCACCATTCACCCCCAATA
TGCTAATCCGTCGTACTTAATAAAACATACGAGTTTGATTACGGCAATGCGATAATTCACTACGAAAGAAAGTAATAATGCTATACTCGCGTATCAACGC
TGCATTACGTCAATATACATTTTCAGAGGTCAAAATGATGCAAGTTGGGTGTCGTACAAAAAACTTAGGTCGAACTAGCAGGTGTGTATACCCTTAACAT
TCAAAAGCGCCATCAATTACTACCAATTTACTTTATGAGCATGCGTTAAAAATTATGTAGCACATCACAACAACGAAGCAGGTGTTGTGACACCAGCTAT
GACCATTTGTGAGCAGCATGCCATAATCTGACGGATACATAACGACAAACTAATATAAAATCTTGATGATGTCCATATGGTTCAATGCAAAGTGTATTTG
TTTCTTTAAACTATTACATATGTGCTGGATTGAACTAACACCTTGACCAAATCAAATATATTTTGCGTGTTGTTATTCCCTCTTGAACTCTCTACTAGCG
TGATGTACTTGGACTTTAAATTCATTAACT