Description :
From Genome Similarity Track
Location :
contig_91:65179- 67289
Transcript NameFunction/comments
g10632.t1hypothetical protein

Sequence
2110 bases(100 bases per row)
TCGGGACTCTTGTCTACGACATCATGAGTGTCAACCAACTCCGACACGCCGATGTCCAGCACGTTGACCGTCTCGGTCCAGTGCTCGCGCCAATAGCGCT
TTTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAAGCTTCACCAGGAGGCAACCGCGTAGCGCCTAAGGTCTTAGACCTCCAATCAATCCATGGCTC
ATGGCGTTCCAGCCATGCCATGCCAGGATGAGATCATATCTCGAATCCAGGTCAAGGACCAGACAGCGTTCAACGCTATCGAAGTCCAGAAACTTCACGC
CAAGGTTCACAGGAACCTTGGGCACCGTAACGCGGGTTCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGCTACCAGCGCCTCGGCATACTG
CCGACTTCCTTCCATCGTGGAGCGTCGAGCATAATTGCCCGACGCTCCCGAATCGATCAATATCGTCCACGGCTTATCAAAGCCCTTCACGGTCGCTTCA
ACGACCAGCAAGCCCGGCTTGCATACACGTTCCGTGTTAAAGAGCACGGTGCTCTTCGGGGCTAAGCCCTGCTGACCTCCTTGCTGAGGCTCAACAGAAC
TTAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGAGCGTTGACGTTTCCCCGCCACGAACCAGGTTTCTGGTAAGAAGCTGGGCTTCGGCTCGCCGGA
GCCTGGCGCTGCTTACGCAGCGGGCACCCTGGTCGCAGGTGCTGGGTGCTCCCACACACGAAGCACCGGCGGATGCCGATGCGCTGCTCGGCAGCAAGAA
GCTCAGCTTCTTCGTCTTCAGCATGGCTGAGATCCATCGGCTCGGGCCCACCCGAGGAGCCGGCGGCTCCGGATGAGTTCGTCTGCGACGTTCCCCACCC
GGCTCGGGCCGACTTAAAGTTGAACTCGGCGTTCAACGCCACGCTCACTGCCTCTTCAAAAGAGGTGGGGTGAACTCGGAATACTTCCGTTCTGGCCACG
CCAGTGCGGAGGCCTTCCATGAAGATGGTCACCGTGACCGCCTCCGGAAGAGGGTCCGCAGCCATACCGGCAATAAGCGTTCGTAACTCTTGGACGAAGT
CCACCAACTCCTTCTTTCCTTGGCGGGTAGCCAGGAAGCGTGATCGCACGCGATAGGCCTGGTTAGGCGGCGAGAACACTCGCGACAGCTGAAGCTTCAG
CTGCTCCCAGGATGGGAACGCGCTGTCCACCGACGTGCCACACGTTAGGGCCCACTCCCGGGCCCGGCCATCCAGCTTGGACACGGCCAGCGCCACGCGT
TGTTGCTCCGTCTGGAGTATGGCGGACGCCATGGCCATCTCGACCTCTCTAATCCAGAGCAGGAGATTCTCTCCTTCCTTGCCCTCAAAGGTCTTCACGC
TCACCATGAGCGGCTTAGCTCGTGGAGCTCCATCCGATGCCGGCTTGGGCGTTGTAGACGCTGTCACAGCCGTCATCTTCTGTTGTAGATGTTCCAACAG
AGCATTCTCATAACTCGAGAACGCCTCCAGACGCGCATTAATCGCGTCGGGGCCTTGCGAAGCAAGATGAGCCACACCTTCCGGGCCCAACAAGGACATC
AGCTTTTTAAGCCCGTCCTGTTGGTTTGGGGGTAAGTGGGCAAATTGCTCCATCCTCACAGAGGGACAGTCGTAAGACTCAGGTGTAGGATTGACTACGA
GTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTGCGTCAGAGGAAGACGTAGACTCTCAGAGTCTTAGTTCGGTTGTAAACCTTGGTTCTATACCAGAAC
CACGTACAGTCTGTAGATATGCGATCTACAGACTCCTAGAGTTATTAATACCTTAAATAAGGCCAATAGACACTAGACTTCAAAACGTGAACTGATTTTT
ATTGTTGTTATTCGCGGCAGGGCCGCCAGTGGGGTAAATGTATAACACTCACTATCTACCATAGTGGAGCCTAGTAATATGCATGACGGGTGGCTGTGAG
GCCACCAACCTAAGTCTCGTGTACACACACCAACTTGGGTGTGCACACCATTTGTGTGAAACACACTATTCGTGTACGATACACTAACGGGTACGTGTAA
CCCCGTTACA