Description :
From Genome Similarity Track
Location :
scaffold_37:6516- 9333
Transcript NameFunction/comments
Pl_111475hypothetical protein PHYSODRAFT_558912

Sequence
2817 bases(100 bases per row)
CGACAATGCACTGACGTCTCGACCGCCAAGCAGTTCGAGCCACTGCAGCCCAGCGACGACGCTAGCGAGAGCTGGGGCACCAAGGACGCAGCATCCGCAG
CACCACAACCTTCAGTCTGGTCGGGCTTCTACAACAAGACATTGCGTGAGCGCTCCGACGTACTGGCGCTTATGTATCCGCGACTCAAGACGCTCAAGAC
GCAGACGGGAGGTGCAGAGGCATCCTCTGACATCCTACCACCGTCGGATCCGACGGCCAAGCTCGGTGAGCTGCCGCTGCGTACAGCTAACCTCATGATC
GAGAATTGCATCGGAGTGCTTGGTGTCCCCCTTGGGTGAGTTGCATGGTTGGGGCTGATGATAGGTTGATGACTAATGGATGACGTGCATTGGTGTCTTT
TGTGACCACAGTCTCGGACTCAACTTTGTCATTGATGGCAAGAATCTGTCGGTGCCAATGGCGGTGGAGGAGCCCTCAGTGGTGGCGGCGGCTTCCAGCG
CAGCGAAACTCGTGGCAGCTGCTGGCGGTGGCTTCTACACATCCACTTCCGGCAATATCATGACGTCACAGATCCAGCTCGTGGGAACAGAGGATATCCC
AGCGGCCATTGCTGCTATTGAATGCAACCGTGAGCGACTGTTGTCGATCGCTAACACGACGCTCTGCCCTAACATGAAAAAGCGTGGAGGTGGTGCTGTC
GACATTTACTGCCGTGTGGTGAGTCAAGCTGCCCGTACTGCTGCCACTGCCGCTAGAAATAATGCCTGGTACACGCCGTGTGACGACGAGCTCGTGGTAA
ATGCCTCTCAACCGCAGACACAGTTTCTGGTCGTGCATATTGATGTGGACGTGTGTGAAGCCATGGGCGCCAACATTGTTAATACTGTTGCAGAAGGTCT
GTCGGAAGAAGTGTCGAAGATCACGCGCAGTCGTGTGGGCCTGCGCATTCTCACTAACCTCTGCATGCAGCGCCGCGCCCGTGCAGTTTTTGAGATCCCT
CTGAAAAAACTCGGTTGGAAGGGAGTGGATGGAGAAGATGTGGCGAGCCGCATTATCGAGGCCTACAACTTTGCTGCTATTGACCCGTACCGCGCCGTGA
CGAACAACAAGGGAATTATGAATGGTGTGGATGCTGTTGCTGTGGCTACCGGGCAGGATTGGCGCGCCATTGAGTCAGCTGCGCATTGCTACGCAAGTCG
TTCAGGTCAGTACGCGTCGCTTTCGCACTACGAGATTGGCCTTGCCCGTGATGGTTCCGGGGTGTGCGTGCTGCGTGGCAGTTTGGAGATGCCAATCGCT
GTCGGATCGAAGGGTGGTGCGTTGATGACCCACCCTGGTTACACTGCCACTCACGCGATTCTACAGCAACCGACGGCGCGCAATCTGAGCGGCATTATCG
TGAGTGTTGGCTTGGCACAGAACTTTGCGGCAATTCGCGCTATCGCGGTCACGGGCATTCAAAAAGGCCACATGGCTCTCCACGCACGAAACATCGCAGT
TGCTGCTGGAGCTCCTAGTGAACTTGTGTCCGAGGTGTGTAGCTACATGCTGTTGCGAAAGTCTATCAACGTCGAGACAGCGAAGGAGTATCTGCACGCT
CACGCCGTGTTTTCGGAGATTCAGAGCAACTCGCCTCCAACCTCTCCGATCTCGGTGACCCTGCCATCCATGTTTTACGTGGAAATTCCCATTCCAGAGC
TCGAGGACACAATCAGCCTAAACATTGCGTTTGAAGCTATAAACAAGCATCCACAGTACATCGCTATCATGGCACCAAATGCGACTAACAAGGATGACAA
GACGCTGACGACGCTGCAGCGCCAGTTGCTTGGCGATAAGGGCTACAACCAGCTCGAGAAGATGTTCCTGTTCCTGGCCTCCCTGCGTTCTATCGTTATC
TCTGCGTCGAGCACTGAAAGCGATCTGTTGGTGTCTCGTTCAAACATCGGGCTGCAGAACAAGCTGCAGTTACTGTCCATTCTCATCAACATCATTGCAT
ACCGCCTCATGGAGGTTCGCCCTCAGAAGGTGCGCACATTCATGCGGCAACTTCTAGAGGCGAGCAGTGGTTCTGCAAACGGGGCTAATGGCGGCGAGAT
GCACGAGTTGGACGCCAAACTCTTCCACGACCTGATGGTGGAGAATGTGGAGCCTGATGACGAAATCTTGTCAACGGGTTTGCCGCTGTTCCTCGCTCTA
TGGCAGGTGATGCACTACCACATTGAACAGGAGGTACCGCACAAGCTGCTCCGAACTCGTCTTGTGAAGGAGCAATGGGAGCTACTAAACGATATCGTCA
GGAGTTACGAGCTCGGCACGCTATCCAATGACACATCTGCAACAGAACAACCGCTAGAGGATAAATTTTTGGCGTATGTCGCTGTGCAGGCTACACGTTG
GCAAGCAACATTGCTGCTGTTGATCGACTCCCTGGCATTGGCCTCGGAACTGGTGACACCTGAACGGTTAGACTTCCTCGCTCGTATTGGCGAGTACATG
GAGTGGGAAGGCTCCATCGCACATGATCTGGCGCGTTACCAGCGCGACGCTACCGAGCGTGTGCCCAACGCATATCTCTTCTGGCTTTCTCAGCGCGGAA
TCCCTCACCCGGAGGGCAAAGAGTATGAACGTGAATTCCGCGCTGTGGCCGACACCTTGGCTGCTGATAAATGGGACAAACTGCTGCAGGAGGCGCGACG
GGACTCGTGGGCTGCTGCCACCTTCTCGTTACCAGCAGTCGAGCGTGTCATTGGCCTCATTCGCGCGATCTACGGCGATCATAGCGGTCGAGGTGTCCGG
AAAGAGTCTTTTTAGGG