Description :
From Genome Similarity Track
Location :
Scaffold_16:6514- 7913
Transcript NameFunction/comments
Physo_131458hypothetical protein

Sequence
1399 bases(100 bases per row)
GTCGTACTCGGCCTGGATCTCCTCGGCCGACTTGCCCGACGTCTCCGGCACCAGCTTCAGCGCCAGCAGGTAGAAGATCGCCAGCAGCACCACGAACGGA
ACGTACGCGTAGTCGTTGAAAGCGTCCGACACGTACGGGTACGACACGCCCACGATGAGGTTGCACAGCCAGTTGATGCCGATGCACAGCGACGACGCGC
TGGCGCGGATCGAGTCCGGGAAAATGTCGGCCGTCATCACCCACACCAGAGGACCCAGCGTCACGCCGAACACGATCACGTACAGCGCAGTGAACACGAT
CGACAGAGCAGACACGTCCACGATGAACGCCACCGTCATACCGATGGACATGACCACCATGCCCGACAGGCCCCACAGGATCATGTTGCGCGCGCCAAAG
CGGTTGGCCAGCACGCCCGTGAAGAAGGCCGGCCAGATGTTGATGAAGTCGATGATGAGCGTGCCCACGCGCGAGTCCGAGATACCGGCGTCCGAGAAGA
TGCTGCCCGAGTAGTAGAACACGGCGTTGATGCCCGACAGCTGCTGCGCCATCGACAGCATGATGCCGCCCAGAAGCTGCAGGCGGTAGCGCGGCGCGAA
CATCGACTCCTTCTTGGGCGCAGAGTCGAGCAGACCCTCCTCGGCGCTGGCCTTGCTCACCTCCAGCCACGACAGAGCCGTCTGCACGTGCTCCTCGCCG
TACAGACGAGCGATGACCTGCTTGGCCTCCTCCTTGCGGCCCTTGGTCAGCAGCCACGCGGGGCTCTCCACGCACATCGACGGCGCCAGCAGCAGGTAGA
TCACGGCCAGCACGACCGGGAACGCAGCCAGGTAGCGCCAGCCAGAGCTCGTGTTGGCGAAGAAGAAGCAAATGGCCGGCACCAAAATACCGATCGTCGT
GAAGATCTGCAGGCCCAGGCCCAGCGTGTTGCGCATGTGCGGCGGCGACAGCTCGTTGATGTAGCCGCCGATCGTGGCCGTGGCCGTACCCGACGAGAGG
CCGGCGATGAGGCGGCCCAGAGCGAACAACCAAATGTTCGACACCGACGCCTGCACGACGCCGCCCACGATCATGAAGATGCAGTTGCCCATGAGGGCCT
TCTTGCGGCCGTACTTGTCGCTGAAGTGGCCGCAGCACAGCGAGCCGATCATGGCGCCGAAGATCCATGCGTTCACGGCGAACGTCCACTCCAGCTTCGA
GTGGCCCGAGAACATGAGGCACGGTCGGCCACGGGGCGCGCATTGCACTCGTCCGTGTCGTTGTACTGCGACAGGTTCATCTGCGAGGTCGACCAACCGC
TCTGGAACGGCTGCATCCACGACAGCAGAGCGCTCGTGTACAGGATGGTCTTGGGCTTGATGAGGCGCGCGGCGGCCTTGTTGGCCTCGTCGAACGCCG