Description :
From Genome Similarity Track
Location :
contig_130:65138- 67950
Transcript NameFunction/comments
g14128.t1hypothetical protein

Sequence
2812 bases(100 bases per row)
ACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCA
CTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGT
GGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACA
GTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTT
CCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGT
CTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTC
TCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCG
TCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTC
GTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCC
TCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCA
CCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTC
CTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGCTTTTGCCCTCCGTCACTCGGTCTCGTCCACAGTCTCTCCACGA
CTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTC
ACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCG
TGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTC
GGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACT
TCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGC
CCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGT
CTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTC
GTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAG
TCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTC
GGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTC
TCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCG
GCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGT
CGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCC
TCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCT
TGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGT
CTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCC
GGCTTGACGTCG