Description :
From Genome Similarity Track
Location :
scaffold_5:651309- 656174
Transcript NameFunction/comments
g8237.t1 hypothetical protein PHYSODRAFT_471854

Sequence
4865 bases(100 bases per row)
GGTTGGACGAGTTCCCTCACTCACCATTTTGCCATTTCCTTGTACGATACAGCCGTCTCCACCCCCCGTCCAGCGGCCGGTATCTCCGGTTTCTTCTCCT
ATGCGAGCTCTAGGCATGCGGTCAAAGATGAGTTGGCACGACATGAAAAAGTTTCTCGTGCTGAATCTCCCGGATGGTTGGGAGACTCGGTTCACTGAAA
AAGGAAGACCCTACTTCTGCAACCACGCCAACCGGTACGTAAAACGCCAAAACTTCTTGGTGTCTTGTGCAACCTAACAGGCATGTTTCCCTTGCTTGCA
GGTCCACCCATTGGAAACACCCACGTGCAGAGATCGAAACGATCTTCAGCGAATGGGTGCAAGAAAATGGAGCATTTTTCAATCGGAGGTCTACCTCTGC
ACGCGCTTCAAAGCAAACGCATGGATTGGTAGGATGATTAATCAACACATTCGATGCAGGATTGCACGCAAGGCAACTGACGGTTCATTCGGGAAATAGA
AAACAATGATCTCACAAAAGATTACGCACACGGGCCATTAACGCGTCTACCACTCACCCCACTCGTCCGTAGACTTTGGGATTTCCTGGGCGGAGAAGTC
GTTCTTGCCGTTGTCAGTAAATACTGACACTGAAGACGTTGGCGAGCACAGTTGCTGGCCGTCAGCCAGCGAGATGTCATCTAACGAATCGTCGAGGAGA
CCTTCCGCATCATGAACGTGATCAGCGCAATGAGCTGCGCTCTCGTGGAATGCACGGAACATTCCGAGCTCAGCTGTGAGTACGCCCATTTCACTCTTGG
CTTCAGCTCGCGCCTTCTTATAGCCTTCCTCAAATGCCTGATCCCGCTCCTGCTTCATGCGTTGGTCAGCATCGACTTTGCCTGCTGTGAGCCCCTTTTC
ATAAGCTTCGCGGGCACGAGCTTCAGCGCCAGCGAGGGCATTGGCAAGCTGAGTCTGCAGCTCATTCATTCGAGTCTGGAGCTTGCTGTGGTCATTCAAA
CCAACTTGAACACTATTCGTAGCCGAGTCCGAGCTCGCCGATACAGCATCGCGCTGCTGTCGCAATGTCGTGAGCTCCGCCTGCACAAGGTCCTTCAACT
TTTTCATCTTGAGAGCTCGCATACGCCAGAGGTCTTTCTCCTTGCTCAGCTCAGCCAGTGCGGCACCTCCAGTCTTATCCGACACCGGTGCACCTTCCTT
TTTTTCTAGCTCCACCAACCGTTCACGCGCAGCTTCAAGAGCCATCTGCAGCTCCATTTTCTCCTTTGTTAACACAGCCACCCTCTCCTCCGAGGCGCCA
CCTTGGCCCTCAGTAATCTCCTTACGAAGGCGCGTCATATCCTCTTCAGCCGCCTGCCGCACACTCTCCACAACCGCCTGACTCTCACGCACACCTTCAT
CGTACCCTGCAGCTCGTGCTTCATCGATCTGCATAGTCGCCGTCGCCATCTTGGTCTCGTACGTGTCACACAGTTCCTGAAGCTGCTCCCCCCACTCTTT
CAACGCCTTCTGCTCCTTCTCATCATAATTCTGCTTAGCTTCCTGTAGCTGGTGGTGCAGGTCTCTCGACTTCTGACGCCACTGGGTGGCTGCTCGTCTC
TCTGCATCCCTAGCGGCCCTTAGCAGCCACACCCCTTCCTGGTCTTCACTGTCTCGCCGTTGGCCAGCAGGAGGAGACAGCGGCGGCTGCTTCTCTTCTG
GTCTGTGCTCGTAGTCTGCATCGTCCTGTCCATCAACGCTGTCCGTATCCTCGTCCTCATCCTCGGGCGCCTTCTTGTTCTCCGTCATGGTGCGTAGCTG
CCGTTCCTGCTCGATCTTCTCCGCCTGCTGCTGTCGGAAGAAGTAGCGGCTCCAGAACTCGTCGTAGCTCAGCTCCAGCGGCACCAGCGCGTCGTGCAGC
GTGCGGATCTCGTTGTCCTCGTCCACAGCGCGCGCGATCTCGTGCGTGTGCTGCTCGGCGGAGAAAAAGCTCGCGAACTCCTTAAAGTCCGCCAGCTCCT
CGTACAGAATCTCGTCCACGGGTCCGGGCCGCGCAGAGCCCATTGCGCTGCTGAGCAGCGTCGCCGCCTCGTCCTGCACCGCCGCCGCCAGACTCTGCGC
CTTCTCGTGCACGGAGCTCACGTATCCCGACGCGTTGGCCGACGCGCTCTTGGCCGCCTGCTCCAGGACCTTCCACATGATGCTGCTGCGTCTGCTGCTC
TTGTCTACACGTCAGAAACGGAATAGGTGACTACAGTAGTTTGGAACGCGAATGAAAGGCGAAAGAGACGGTTCTCCTACATTTGTGTACGGAACACCAG
GGAGATTTTAGACATATGAGCGTCTTTGCCGTCTGGTTAAGTTATGTGATAACTTAACGAGATGAGTTTTTCGTCTTTGTTGAGTCAACACTTAACCGGT
TCGTGTCCCGCCCCCAAAGTTCAAGATGGCGAGCGATGGCGAGGGCTCCGATGGGAGCACCGACGGGCTCGGTGTGTTTCCTGCTAGCGCTGTTCAACTA
AGTCTATGTGATCCAGGCTAGCAGTTGCTAGCTCAACCGTACAGCTTGTCAGTGGAGGCAGCCTCGCTGAACGAGGGCTATCAGAGAGGATTCGCCGAGC
AGGGCCAAACGTTCGAGACAAGAGAGTCGCAATCCGCTACAACAGCACGTGATCATGCCCAAGAACGGTGGGAATCACCGGCAACAAGCGCGACACCAGA
GGCCCAGCTACCAGAGACCCAACAGGGGCCCAAAGATCGGGGTCTTCCTGCAGGAAAATCGGGACGAACGAAGAGAGGGAGACCACCGAAAAACAAGACG
AAGGCGCCGTTTAATTGGACAGACCCTCGCATTGACATTCTTCTGTGCCATCGCTTCATCCAACTGAAGGATCGCTTTGATAACGGCAAGTCAAGCCAAC
TGTGTAAAGTGAGCTGGCGATTGCTGGCCAGTAGTGTCAGCACCGCCGTGGGCGAAGAGATCGACGTGGATCAGTGCAAGAATAAGGTACCGAATAATGT
TTGATGACGTGTTGTCTCTGACATGTTGTAATCAATTGTTGCGCACATGCAGCGGTTGTGGCACTCGTACAACAAGGCGCGGGACCAGACAGGAAATGCT
ACGCCGCCTGAAGAGCCACCGTGCTACGATCTAATGCATCACCTATGGTCTAAAAGCAACGGTATGAGCTCGACGCCATTCATCTCATCATCCATTCGAC
CCCCAGCGTCGACACAAGGCATCGCTGCTCAAGAACTTACCTCTGATGAGACGGTTAGCCAGTCCATTGCATCATTCCGTTCCTCCGAAAACCCAGCTCA
AGGATCGGTCACGACTTAAACCCTCCGTCAAAACCCAAGCCTGACGTCAAAACCCAAGCCTGAAACACAACGACCAAAGAAAAAGTACAAGACGCAAAGC
GAACATGTTGCGGAAGGGATGAAACTTTTATCCAAGAGTATATCAGAGGTAGCCTCTGCAATTTCAAAGCCAGCAAGTGAAACCATCGCGGAGACCACGA
ACCAGCTGGTGCTGCAGACGCTTGCTGAAAGCCAGCAGCGCCAAAACCAACTAACGACCCAACTTCTGGAACACCACCAGCAGCAATCGAAGGCAATGCA
GTTGATGTTAGCCCAACTCACGAAAATCAGCGAGAAACTACCCGAGAACAAGTGACATGATCCCAGTCCGTTTAGCAATTGCTATTCCTCGAACTGTCCG
AGTGGATACTGAATCTGGCTCGTCATTGGGGTCATTATTGGTAGGCTCGATTGCTTCGTCAATTTCAGTTCCGTCTCCCAGCAAAATGAAAATGTTATGC
ATGACAACTGCTGCAGCAATAATGCGGAATGCTTTGGGCACTGTTTTTTCAGCCATAATGGTCTTCAACCTGCAGAACCTCCCTTTTAAAAGCATTCTTC
TGACTTGCGAGAACGTTCTCAAGCTTGTCATAGAACTATGAGGCCTGGATACCCTCATATACCATATTTATCGGCCCCAGTGCGACAAACTGTCCCAGTG
CAACACTAACTCATGTGGGGGTGACACCCCTTTCCACACCTGTTATAATTCATAGATTTAAAAACTGTCTAAAAGAATATGTTTATTCGCTATCAGATTC
AACTGCGTCAACAACACATTCTTCTGGAAGTGAACGCAAATACGTCCTAAATGCGCCTGCAGCGTCACGGGGTCCGACTGAAAGTAACTTAGCTTTGTGA
AATCCGTTCACAATAGTCTCTGGGTTGACACTCTCCCATGCTTTCCCGACCAAATGAGAGAGCATTGCACGCCGCTCACCGGCCGTTGACGGGAAAGGGT
GCTCAATGTGATACTTCACGTACAAATCCCTGCTCAGAAACAGAGTTAGTAAAATCATCAATCAATCGAAATCCGTGCCTAAAACTTACTGAATCTTTGC
CTTGAATGATCGCATGACGCTAACGTCCATGGGCTGGCTTAAACCGGTGATCCCTGCAGGTATGTACTAGATTTGCGTCACACATTCATCCTCAAGGTGC
TCGCGGATGCTCGTCATTTTGTGTACCTTTATAAAAGCTATCTAACAGCAGCATCCGGCATCCAGTTATGCTTGGACGCCATACCTACACCAAAGCATAT
TACAACCAGATGTTAATTTCTTTGTAGTTGCACAAGACCATATTAGAACGTACCTTTTCAATCCATTCCATCATAATTGAATGATCACAAAAGGCTTTTG
GCTGCACCGTGTGTATCACCGATGAGTCACCGAAAGACGGAACTGACACTTCTTCTGAGACGGGCCCCAGCAAATACGACGAACGGTGCGAGCTTTTTGC
CGGTTGCGGATGCACACAAAAACACGTTACAGCCTCCGCCGTTTACCGCAGTTCCCTGAACAATG