Description :
From Genome Similarity Track
Location :
scaffold_4:651185- 653312
Transcript NameFunction/comments
Plaha_PHALS_08627hypothetical protein

Sequence
2127 bases(100 bases per row)
GGAGCTATCGGGTAGCGTAACGCTGTAAAGCATGTGGATTTTTTTGCTCGCTCACTTTGTAGAGTCATTTCACATTAACATACATATACCAAAATTATAC
CAATTCTTCATAGGCTTTTGTCAAATGTTAAATTATGTCACAAATCGACATTAGTGTGTCCCAATCAATTGTAATCGACTTGTACATGACTTTGTAAGAA
ATTGACAATTAGCCATGACTTATTGGGGGTCTACAATAACTTACTAGAGTTTCTCCCGATAGTAGTATATGCATTCTGACTCCCAAATTCTAGTACTAAA
AAGAAACAGGGTTTGCAACGAGTTTGCCATGCACCTTGCAtcgaggaagctttgacacaCAGGGTTCCAGGTTAATGAAGGATGGATTGTACGCTTTACA
AAGAGCGGAGCCAGGGGCCTTATTAAAATCGAAGGTTTGACGATACACAATAATAAAGTTCTCTCAATGTAAATATGGTTGTGTTGTGCACGTAAACCTT
ACACATTTCATCTCGTTTTGCACGATCGTACGAAATTGACATTGTGCTattgtgtaattgtgaatattaaTATTCGAAGTGTCTTTCCTGTAAAGGAGAG
ACCCGAGGTACACATGGGCATACAAACAGTAAAACAGTTCGTTATGAGATATGGTCAATCGCATAAAGTAATTAGTTTTACTCCCAAATTCATGTACCTT
CTGAAATAGTAGGTCAAGCAGTATATATAGTAACCGTAGAGCCTCTAGTTAGCGTGGACTCTTTTGAGTCACAAAGTCCACCCTTTTCTGCACAAGGTGC
tgttgcatttgatagcACTATGTAACGAGACAAGCATTGTAACTTTGTGTTTTTTACCCCTATATACTTCGTGATAATCTGTATAAAATTTACATTGTAT
TATCTAATCCGAATCTATATCGGGGTTGCATGGACCCTGATGTGAAGaggtggatcacacaagatgtgtgACTGCACAATGGTGTAACTTCATCTTAATC
AGAAGAAACTACgaggctggactgccagtagttatgcatttaatgAGGTTTTTCTATTTCATTTGGAAAACCTATGAAtttaaatataggcggctttgcc
gcaaataaaacacaaGAAGTGCATTTACACTCTGAACGGAAGaggagtttatttgcctcgGGTttgactcttggagtaagcgaattgcgatccgctacac
tcgtattggttctaaTTAAAGAAAGAGCtaaggcagccccgctgcactcggtAGTATTGTAGTCAAGCTACACCTatgtcgttacgactgatcctctgtg
actATGGAGTAGTTCtactctttgccccagggcatgcaggacgggcttaaaaagctgatgtctttgcttTGACCTGAGGGCGTGCGCCAAATCGCTTTGC
AAGGACCtaaagcgatcagcgcgcgcctggAGGCGTTTTTAAAATATGAAATTGCTATACTGGCGCACCGAGAGCAGTAGATATCGGTgttgactgcgtc
catgacgccaccgtcggcgacggatgacCCCCCCCAGAatcaagccgctcatggtgggaGTAAAGACCTTCAAGGgtaagaatggagagaatctcctgct
ctgggtaaaaGAGGTCGAGATAGCCATGGCGTCCACTATGCCCCAGACTGAGCGACAGtacgtggcgctagctatccaTAAGCTCGGTAGTTAGCGAGAG
AATAGACACTGACGAGTGgcgcttcggtcgaagcAGTGTTTCTCTCCTGGACGGagttaaagctgcagctttaacGAGTGTGTCTCGCCGCCTacccagg
catatcgcgtgcgatagcgtttccttgccgcccgacaaggCAAGCAAGGATTGGTGCACATTGGCGTGGTCACATCTTCTGTGCACCCTGTCTTCTTTTA
AAGAATCAGTGAGTGTGACATTGactgccaaattcaactctacgtcggcacgacttggtagaaatgcacactctacagctcgtcgagcgggcctgagcca
atgaatctcagctatactGGGGACGAGGTGATAGAGATCCGAGCTGacgagcagcgttcgaacacttGACGGTGTTTTGCCTTTATCGCCTTTGGATTAA
Ttttcccttgcgcaaggcgcatcaagg