Description :
From Genome Similarity Track
Location :
Scaffold_23:65102- 67729
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.66Rho-associated protein kinase 2
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.67Calmodulin binding protein

Sequence
2627 bases(100 bases per row)
TGAAAGCCGAGTTGCTGGAAGGTCACACCAGTAAGCTTCTTGCATACACACGCGAATCCCTTGAGATTGGCGGCTGCGTTGAGCAGTGCAACGCTTTCGC
GGATGCTAGCTCGCGAGTCGATGACGTTGACGTACAGGAAGgTGCGTGAATTCAGCGTTAACAGCGGGTGgAGGAAGTTGGACAGGAGCATAATTCTAGT
GACCACTGGTTGCTGTGCTCTAGAGTGCTTGGGGGTCgAtGGAGATCGCACAGAGCCACCGGAGGCAGCGACGGTGGCTGTTTGCTGTCGGATCTCTCGG
AGGATGTCGTAAAACTCTTGCTTCTCCTTGGTTGCCACATCATCTCGAAAGTCCTTGAGGTCAGCGAGATCGACGAAATGCAATGTGCTGAGCTGACCCG
TGGGAGTGTGGAAGAACGCTAGCCGCACGAAGAAGTGTGAATGCTCGTCTGTGTGCTTCATAACGATGCGATGGGTCTTGGCTGTTtGAATGGTCTGCAG
CGCCGTCCTGAGACTCGTCGCCTCGATGGAGACAAACACCAACGGAGCTTTCGGCGAGGATGGAGGAATTGACGGCTGGGGCTTCAGGAGATCGACGGCT
TCGTTGTTGACGATCATCCAGCTACTCAGTCCAAGTTTCCAGTCACTTTCTCGGTCTGGGCGACTGAAAAaGTCGAGGAGAAGACCGCCTAGTTGTCCAT
GAGTATCCACGGCATCTCTGACTTTATCGGGCAGCGAGATTGACGACAACGATGGGTAGGAGGCCTTCCCGAAGAGAAGACGGAACTTCTGCGTCGGGTG
GATGCCCGTGGCGAGCACAGTGGTGTTAACGCCGTCTACAAGGGCACTGCGAACTGCGGACTGTGAGATGTTTTGGAACACGTCGTCGGCATGCGTGGAG
GCCGTGGAGGCAAAGACCGAGTGGAACTCCCATTCGGCAGCAGCACTGGGCGAGCCGTCGCCACTGACGAGTGCAGCATTTGGAGATGGGAGGGCCGGAG
AACTGACGCTGCTGTCCAGGACCGGAGGTTTTGAGACGACTCTCACACATCGGCGGTCGGGCTGGACATCGAAGACGGGAGTGGCGCGGTTGGCTGCTGT
GACGAAGCATGACACATGCAATTGCCCGAGCACGACGGAGGTCTCGCCACCAATGCTCTTGCGAGACGCCATGTTCCGCAcTTGTCGTGCCGTTTCGACA
CCTGCCTATTCTAGGGAAGGATAATGAAAGGAaGAACAAGAAGCTAAATGACAGGGAAGCTCTTCATTGCGGTGCTACGTGGCGGtGgATGGTCACTTAA
ATAGACTGCTACTACTACGATACTTTATGCGGGCACCACGTTCGCCACGCTCGGGATGGATAGCCACGAGAGTGTtCGTTTGCATGCCGTCCTAGCCCGC
AACAGGGCTCCTTCTGATTGATCATGATACAGTACAGGTCCCCGACGGAGGCCAACTCCTTCGACTGGCCACGTCGGGGTCTTGGGGTTCTTCTTCTCAT
CTTCTTCTCATCATTGATACTAAAGTACACTCGCTTGACACTACTCGCAGACCTGCCTAGGACTGCATTTCACACGTCGCGAGAAGTTCCACGGGATCTT
CGAAGATCGCATCACACGTCGACGACGCTCGTAGGAGCAACGACGGCGGCCCACGCTCTCGTTCCACAGGGGCAAAGTCGAATGCGAAGTCCGCAGTCGT
GTCACACTCCTCCATCATAGCTTCGTCAGCTGATTCATCAATCTCCAACACTACGTTGTGCTTGCGCACCACAGTGTCGACAAGTTCGTCAAACATGCCG
ATCTTCCACGCAAGATGCTTCTGCTCAAGGAAGTAGAGTACGCGGTAGGCGTTCCAGAAGTGCGCGTTGTCGAGCTTCCGCACCAACGCGCCGTTGATCG
AGTCTCGAAAAACCTTCTGGATGCGCTGCACGTCCACACGCACATCCGACATATCTACGCCCTGGGCGACAAGAAAGCGCAGCAGCACGAGCAGCTCGTG
CTCCGACGGCCGGTAGTGACCACTGTGGGGATAAATAGTATGAATGACCCCGTCGTTGATCACCATCATCCCGGCTGTCTGGACGCACTCTCCAGCCACG
AAGCTGGTGTGATGAATGCGCGGAATCTTCTTGGTCTCCTTCTGTCCGCCGTACAGCACACCGTCTCGCAGCACAAAGATCCATCCTTCTTCTCCGCTTT
GCACAATCTCCTGCGAGGCGACGTGGTACACGCGACCATCTCGGATCGAGAGCGCGAATTTCTGGCGCTCCGCTTCCGTGTCACAATAGAGCACAGTCTC
GCGCTCGAGCTTTGTGCGCGGGACCCCTTCGACCTCAACTGACTCATCGTCTAGCCACTCCCAAAAGCTCGTGGGGCCTTCGGCAGCTTGGCGCTTCCAC
TCCTTGTAATACGCACGCAGGTTGgCGCCGTAGCGGTGCTTCCGGTCGCAGACTTCGAGCCAGCTCTTCTTGTCCACGACCGAGATGTTGCCGGCGCTGT
AGCCCTTGACGAGCTTGGGCGAGTACTTCTTGGCCAGCTTGACGATCTCGTGCATGTTCTGGTAGGTGCGTCGTTTGGCTCGCATGCTCTCTGCGGTCAT
CGCCCACGACGCTGCTCTCTTCTTGGC