Description :
From Genome Similarity Track
Location :
Scaffold_606:651- 3754
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_606-fgenesh-gene-0.2DNA ligase

Sequence
3103 bases(100 bases per row)
ACCTAAATGAGCATGTCGTCATCGTCGTCGTCGCCAGCGCCGCTCACTGTCGCGAGACCCTGCGCACGATAAAGATCTGCAATCTACACGCAATAACAAA
TTCGTGCGAATGAAACAACAAACAGCAGCAAGGTTTAGAATTGAAGACAGACATGTAGATACACAGAGCCAGAAGCGTATCACCTGATTCGATGTCGTGG
CTTGCGTGGTGTTCTTGTCGTCACGAATGCGGATGAAGCGCGGGAAGCGCAGTGAAATGCCCTTGTCTCTCGCCACGAGCCCCATACCAGCCGTATACTT
GGGCGAGATGGACAGATCCGCACCAAGGATCTCCCAGACGCACGTTGGCTCGAACCACACGTCCGGCTTGATCGCGCCGTCCCCAACCGCATAATCTTGC
GGCATCTTGTCCGCCACTTTCTCCTTCAGCTGCTCGTAGAACTGCTTGAGCACTTCGTCCGACAGCCCAGTGCCCAATTTGGTGATCGGCTGGTACATTT
CGGTCTCCGGGTCGTAACATGCGAGCAGGTACGCGCCGTAGACGCCCGTACGTTTGCCTCGGCCGAAGAACGCACCGATCGGCACCAGATCCGTGGAATC
CCCTATGCCATCGAGATAATCCTTCTTGAGCTTGAGCCACTTGTGTGATCGGTTCGCAGGCTCGTACGTCGCCTCTTTTTCGAGCGTCTTGACCATCAGA
CCCTCACAGTTCTCCCGCACAGCCTCTTCGAGGAACGTCCGCACCTTGTCGACCGCGACCTCCATGGTGTCCGCGTCATCCTTGACAATTTCTGTCGCCT
CCACGTCGATGGACGTTGCGAGTTCAAACGAGCCGTCTTCCAGCTCAAATATCTCTTTCAGCTTGGATCGACGCTCCGCCAGCGGCGTGGTGAGGTACGA
CTCGCCGTCGAGGAACAGCAAGTCGAACGCGTAGATGCACACAGGTACCTTGATGTCTTCCACTTTGACGTTCTATAGTGCAGAGCATACAATACGTGTG
AGCCAAGATTGCATAAGTACAGGAAATTGTTCAACAAAACAAGACAGCAAGACAACAAGCTTACCTTGCGCGAGCGCGTACTCAGAATCTGGAACGGCAG
GCGCTTGTTCGTCGCCTTGTCCACCGCGACGACCTCGGCGTCCACGATGCAGCTCTTTACGTTGTTCTTCTTCGCCGCCTTGGCGATCATGAGCTTTACA
TCCGGGAACCGCTCGGTTGAGTTCTCAAAGTTACGCGAGAAAATCGCGATCTCGCCGTTGGGGAGAATGTGGATCTGCGCGCGCTCGCCGTCGTATTTGT
ACTCGCACGTGAACGGCATGCCCTGGAAACGATCGAACACCATCGCGTACGCCTTGGTGGGTCTCGCAAGCATCGGGGACACGGGCGTTCCGGGAGTCAG
CACACAGCGTTCGGCCACCTTCGCAAAGTCCTTCACACGAAGCAACGGACTCGTCGGGGTCTCTTTCTGAACCTCTTGGAACGCCTCCACGAGCGCATTG
TAGCTCGGACACTCCGCAAACGCCTTCTTCACGTGCGCGAGCGCCTCTTGCTGCTTGTCCTTGTCGCTCTGATCCTTCTCGAGCATGAACGCGTACGTGA
GTCCGATCAGGATCGACTTTTCCGCGAGCCCGATGCGCAGTTTGCCCTGGAGCCCTCGGATGATGTACTTGGCACCTTCGGCGGCGCTCTGGCTCGCCGT
GTTCGTTTCGTTCTTGCGGTCCTTCTCGCATTTCACAAGCAGGCTCTTGATGATCGAGCACTTCTGCGCCTGCGAATTGTTGCCCGTCATCTTGGCAATC
TTGACAAACTGGTTGTACACGTCCTGCACGCCCAGCACGCTCGGCTTGGTCGTTGCAGTCTTGNNNNNNNNNNNNNNNNNNNNNNNNTCGACGCGAACGA
CAGCGTGTGCTGCTTGGAGCGCGCGTTCTGCGCCACTTTGCCCAGGTCGCCCTCTTTCTGGTACATGTCCTTGATGAACTTCATGTTGGTTCCCGTAGCT
TCGCCGACCGCCTTCATCAGGATCGCGTCGCCGATGCCGATTTTGAGGTTCTCAAACGGCGGTGCGAGGTCCGTGCACACGCACAGATAGATGCACGCGA
GCAGGTCCTGCGGCGCGCGACGGATGACGTCGCGAAAGAACTTAAGCAGCAGGTCCTGGATCACGAGACGGCTCGAAGTCGCCTCAATCGTGTTGAACAG
GTGCGCCAGCGCCGAGTAGGGGATCGTCGAGGAAGCCTCGTCGTCCCCTGCGTCGGCAGCAGGACTCTCGACAGATGCTTCTGCCTTCTCCTTGCTCTCA
CTGGCCATCTCACTGGTTTCTTCAGTAGTACTATCCTTGGTCTTCTCCACGCAAGCCGTGAAAAAACCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
TTTTTTCGCCTTGGGACTCGCCTTCATTTCCGATTCTTTCTTCTTCTCCTTCTTGTCGGACTTTACTTTGTCGTCCTCTACTGCCTCTTTGGTCTCAGTC
TCAGCATTTTCATCTTCTTTATCCTTAGATGGCGATGGCTCTGGTTGCTTCACTGCCTGTTTCTTCGTCTTCGAGCTCTTGACAACTGCAACAACAAGCG
ACTTGACTGGCGTCTTCGGTTTATCCTTGACGTTGTCGTCTTCCTCGTCAGACGCAGAGTCAACGTTAACAGGGGTGTCCTTGGTCGAGGCAGCCGCAGG
CTTCTTCGCAGGCGGTGGATTCTTCTTCTTTGTCACGAAACCAAAATCTTCGTCGTCATCGTCATCGTCGCTGTCAGCGACGCGCTGGCGTAGGCGACGG
CGTCCAGCTGTACAGTACGCAAACAACAGGTTAGTGCTCGTTCCCAAATTGTATCCAAGCGTTCGAGTCAATAGTTAGTAACGTACGCTTTGCCTTTGCA
GGTGTTGCCTTCACCACCACAGCTTCCTCGCCATCGTCCTCATCTTCGCTGGCTGGTGTAGCTGGTAGCTCTTCCTTCTTCTTCTCAACGACCGCTTCTT
CCATCTCCACGTCATCAGCATCAGCATCAGCGTCGCCTTCCGGTTCGTCCGCCTTTTCCGGTCCCTCGCTCACAACGTCCGCATCTGCATCAGGTGTCTT
CTT