Description :
From Genome Similarity Track
Location :
Scaffold_5:650994- 683060
Transcript NameFunction/comments
Phyci_101084conserved hypothetical protein
Phyci_24221Hypothetical protein
Phyci_209956Hypothetical protein
Phyci_210067hypothetical protein
Phyci_265202proteasome subunit alpha type-3, putative
Phyci_76708Hypothetical protein
Phyci_158591hypothetical protein
Phyci_210065Hypothetical protein
Phyci_209851Rab7 family GTPase, putative
Phyci_491938Hypothetical protein
Phyci_209873Hypothetical protein
Phyci_209584Hypothetical protein
Phyci_89755Hypothetical protein
Phyci_300272indigoidine synthase A family protein, putative

Sequence
32066 bases(100 bases per row)
CGGTGGGAGGATAGTCCACTCATTTATGCTGCTCGAAATGGTCATCTCGCCGTATTGGACGGTGTACACCGGCTCGGAAGTGACAGTCTAGGCGTGCTCC
AGAGGTTGATTCAAGATCGAGAGATTGACCTGGCAGATGGTTCGAAGTTGGTGTCGCAGGTGACGTACGATGCTGTCGTAGCTGATGCAAACAAAACTGG
AGATGCAAGCGCGCTAAGTCGGGTATCAGCAATCCACCCGTCTTTTCGTATTATTGCGATCGCCGAGGCGGATCCTGCAACACTAAGAGGAACAGCAGCT
GCACCAGGCAAGGAATCTACAGCTGCGTGGCTGAGCTCGGATAGCATCTCCATGTTTAGCTTCCATCACCTCCCAATCATTTCCTCTGGGCAAAGTGAAG
AGATTGTACGACGTCTCTACCCTGGGCTCCCAGAGGAGACAACGAGGTACGTTCCACTTGGGTACAATTTGATTTGCAGCTGAATAACTAATGTCTCGAA
TTATGTTCTTCCGCCGTATCGAGCAGCATCCTGCTCTCATTTTCGGAAAAACTGCGGGATGCAAAGGAGACGAGTGCCAATGCAGACTATCTAGCTCTTT
CACTGTCCATACGCCAGCTTTTGCGCGCTTGCCGTCGACTAAACGCATTCCCTGAACAATCACTGCGCGATTTGCGCCCGCTGCTTCATGACACGCTGCT
CACTCAGTTCCTATCTGCATCTTGCAGCCGACTTGTTGATACTTTGTTGGACGAGTGCAACGTACCAGTCTCACTATCGACATCCGATACCCTAAAGCAG
CAAGAACTGGGTACGTAAAGCATAAGCCTTTTCATGTATTTTTCAACTAATGCTTGCGTTATTGCAGATACTATCCGAGAAGAAGGAGGGTATTTGTACA
TTGGCGATACCTCCTACCCGATTCAATCGCCCAATAACCCCGAGTTGGTCCCTCAACCGCATTATTTTGACATTCCGAAGCATACGCAGTGCATGCAGGC
TATGCTCCAGGATGTTGTGGCTGGTCAAAAACACATGCTGCTCATTGGTAATCAAGGCGTGGGCAAGAACAAGCTAGCCGATCGCTTGCTGCAGCTATTG
CAGCAAGAGCGCGAGTACATTCAGCTGCATCGCGATGTACGTAATTGTAGGTTGAGGTGTACGAATACCTGTGTATGAAAGCCTAACAGCAGCATGTGTG
TCTTTAGACAACCGTGCAAACACTCACTCTGGTGCCGACTCTTATCGATGGGAGGATTGAGTGGGAAGATTCGCCACTGGTTCGCGCTGTCAAAACTGGA
CGAACACTTATCGTTGACGAAGCTGATAAAGCCCCACTAGAGGTGGTATGTGTCCTCAAGGGACTTATCGAAGATGGTGAAATGCTGCTGGTAAGACGTC
CACTTGAAGGGGGGGGGTGTTAATCGCTTGATAGCCATGCTCACGGAGAAATTCCTATTTGACGTGTTCTGCTGTATTACAGGGAAATGGCAAGCGTTTG
ATTGACCCAGCGAAGGTGACGATCGAAGAGTGGCACGATGAAGAAAACATAGTTGAGCTTCACCCCAACTTCCGAATGTGGGTCCTCGCCAATCGTCCAG
GGTTCCCTTTCTTGGGAAACAACTTTTTCCGGGAGATTGGTGACATCTTTGCTAGCCAGTACGTCTCCACGCATTGTAACGGCAGAGCTTGCTGCGGTTG
ATAGTCTCCTCGCCTGTATTTGTGTTAATCTGTAGCGCAATCGACAATCCGGACGAGGAGTCTGAGCTGTCTTTGTTGACTGCATACGCACCAAGTGTTC
CAGTCGACATTTTGCGCCGGCTTTGCAGAGCCTTTGCTGAGCTACGAGAGCTGGTTGAAAATGGTACCATCACGTACCCGTACTCGACTCGCGAGGCCGT
CGCTGTGGCGAAGCATCTTCAACGATTTCCAAATGATGGAGTTGCATCAGCTTTGGTAATGACCTCCTTCTAGTAAGGAGTGAATCTGTGCTGGTATCAG
ACTAACAGATAACTTGCGATTTGTAACAGGAAAACGTCCTCGCATTTGATGCGTACGATCGTAACATGCGGACTCAGCTGTCGGAGATCTTTTTGAGGTA
CAAATTACGAGCGTAGTTTTGGTTGTGTACAAACGGTTGATTGTTTGTTTGCATGTGCTAGAAATGGCTTGAAATAGAGCTCGCACACTAGCTCTGCTTT
TTGGCATCACGAACAATGGAACTAACATCATTTCATGCGTAAAACTGTTGATTTGCTGGATGTATTTTATTCCCCAGGCATGGAATCCCTCTTTCGGCCT
CTGGTGAAACATTGGTACTAAAGATGAACATTGCAGAAACACGAAACCTCCCCGACCTAGTTCCTACGGAATTGTGGCGCTGGTTTCCTGAACAATCGGT
ACAATTCAGTGCGGCTACCAAGAAACCACAGCAGCTTCATCACTCGACGCTCAATCGGAGACAGATTTGGCTGGATCCCTCGACGACCAGATCATTCACG
CTTCAGCATCATCGTTTGCATGAGTTTTCGGAACAACTATCCTCTTTTCAGGTGCCTCTAAAGGGGAATCGAAAGCAACAAGCTCACACAATGACAGTCT
TTCCCGACAACTCGGTACATGGTACGTGAATTGTCGGTTTCAATTTCTGTGGCTGTCGTGATGGGAAAACTCATAACTCTCGCTACTACATTTTATCTTT
GTTTGGTAGTGCTTACAAGGCGGCCGATGAGTGTACACTCTTTTTCGGATTTCGATGGAAATGAGAGGTACGCTTGCTTGTTTTTGTGGAGAATGCGGAG
GTCTAATCATGTTTTGTTGGTCATGCATCTTCGCAGAACGCATAATATATTAGAGCTGGAAAGCGAGTATATGCAATGGGAGCCTAACCCTGTGCTTATC
AATTTACCTGACAAAAACGAAATCGCAGTCTTCATCCCATCTACAGGTAGGCAGGAATACTGCATTTATGCTCTTGACAGCAATTAACCTTTTTTGTTAG
GACTCACTATTTTCCTGAACCCGCTGGGTAACGCTGACGGACGTGCCGATTGCCTCACCCTTCCTGATGGCGCGCTAGATGGTCGGCTCCATGTCGATGC
CTCGGTGTTGCAAGGAAAGAAAAAGGCAAAGCAAAACCCGTTCACGAAGTGGTTTGGGGGTGGAGATAACAGTGGGTGGAGGACCGAGGCCGATCGAATC
AATTCCGGGTTCATTCTGCGCTACATGCAAGGAGGCTCGCTGCTCCAAGTTCTCGACCTCAACTCGCTTAACTTCTTCTCAATCGACCTGGCCAAAATCA
GCGCGTACTTGCCCATGCCAATTGCTGAGCTTCTGGGTGTCCAATCAATTGGTAAACGCGAATGGCTTCTACGGACAACCGACGAAACAGCGGTATACAA
ACTGAGGCACGAGGCGCGGAAGAACGAGTTTACTTTAAGTGCTGCAACAGTTGATAACAGATCGGCGACAGGTTCATCAGCATTGGATTCTCGACATTCA
GTATTTCCCGGGCGAGAGCAAGAACAAGGTGCAGTGGCCCCTGCTACCTTCATGGTTCACCCACAGGCATTTTTACAAGTGCTTGATGGCGACGACAGTA
ATCTCACTATCCAGAGTTCACCACGAGAGAACACACACAGGGAAGTTCAACAAGCGTGGCAGAGTGAATCGTTCATTCTGAACGCGGTGCAATCGAACAC
AGGCGATCTCGTTGACATGGAAGTTACATATCCCGAAACCCAGTCGACGAAAAACGTGGTTGTAGGTTCGGCCTCACCTACAGACAACGAGGGTGACGAT
AGCAGGTTTTTCTCCTTGTCGACCAAATCATCGTACGTTCCACGCGTCGTTGATGTAGCGAGTGTGCACAATGGAAAGCACACGCTCACACTCCAAGAAG
ATGGTGCTATACGAGTCTGGCAACTAGACCAAGCTGAGCTCGATCGTGAGGCGGAGTTGTGGAAGAAAATGTACGGCAGCGCAGACGAGTTGGCAATCAC
AAGTGATCTTGACCTAAAGGTTGATGGCGCTAGAGTTGGCGGACCATCGATCCCCAAAACAGGGTTAGATACACCGAAATATGGCAAAGATGACCCAAAC
AATGATCCACACGTGGGAGGAAACACCTGGGCTGGTGGGACCGGAGGATCCGACACGGCAGGACTGGGTGGTCGCGGTGGGCCATATCGGCTAGACAAGG
GCCACCCCGTTCATCAAGTCTCGCAAGAGAAGAAGGACGAGGTTTCAGCTGAAGCTCGTGCGAAAGCTCAAGCTATGGCTCGGGAGGCTCTAGCTGACAA
ACTTCGAGAGATCGACATGAGTGATCGTGAGTGGGAAACTTACCAGTCCTACTTCAAGCGAGTGGAACGAGAGAGCGCTCAGCTGCGTGCAGTGCTTGCA
AACCTCGAGGCTGTTGCTCAGGAGCGCAACTGGTTTCGCCACCAATCCAGCGGTGAGTTGGATGATGGCAAGCTCGTCGATGGTGTTGCTGGTGAACGCC
TCGTATTTAAGCGTCGGGGCGTGAGCGACTCGCCTTTTCAAGCGCCAGCAGGCCACCAGCAGGGCCAGAAGCCCAAACGAATGTTGTTCGTGATGGACGT
GAGTGGCAGCATGTACCGGTTTAATGGCCAAGACTCCCGACTCGAGCGTATGCTCGAGACTTCTCTAATGATCATGGAGAGTTTTGCCGGCTTTGAACGC
GAGCTGGACTACTGCATTATGGGGCACAGTGGCGACTCGCCCGAAATTCCTTTCGTGGAATTCGGAGCACCTCCCAAGGACCGCAAGGAGAGGCTGCGGG
TGTTGCAGAAGATGGTAACCCATACTCAGTACTGTCGTAGTGGAGACCATACCGTTGAGGCAGTGGAGAGGGGCGTCCAGCGCGTTGCTGCTCTTGAAGG
CGATGACCGCTTCGTGTTCGTAGTGAGCGATGCCAACCTGGAACGCTACGGCATCGAGCCCAGGTATCTCGGTCAGAAGCTCGTTTCAGAGCCTGGCGTT
CAAGCTCATGCTCTCTTTATCGCGTCCTTTGCTGACGAGGCCGAGTGCATTCGTCGCGAGCTGCCTGCAGGCCGAGGTCATGTTTGCCTCGATACTTCGG
ACCTGCCGAGGATGTTCAAGCAGATCTTTACAGCTGCTTTCGGTGGAGCCTAGTTGAATGCTTTGGCGCCAGCATATGGGAGTACTGCTTGAGGTCGCTT
CGCAATCTTGTAGCAGTCTCCCCAGTCTGAACACTGAGCGTGAATGCGCGCTTCACCAAATACTCGAGATAAGGACTTCCGACCTCTACTTGTTCCTAGG
ATGTGGAGTATTGGTTCTCCAATAGGCACTGCGACTTTTTAGGCTGACAGTGCCCCCCCCCCCCCCTTAAATTTCATGAACGCCTTCAACAACTGCTCCG
GTGCTTTGACTTCAACATGGTCGTGCAAGCACCGCCGCAGAGATCTTCATCAGTTGCTCCGCGCAGACAAGCAGTGCAACAGCGAGCTCACGCAACCTCT
ATAATCAAAGCCAAAGCCGGGTTGCATGTGCATGAAACCTTCGATGGCAGAGACTGGCATCGTGAACTCCTCAAAACCGCGTTGACTCAAACCGCGTTGA
CTCAAACCGCGTCCGTTGGGTAACGGCTTCGCAATGCTACAATGCTAAGCTAACACCCGCTCCGGTGCCAACGTGGCAGTGGGGAGCGCAATGCGAGGCA
GAGCACTCCTGAGCTCTCTTCGCAGTTGCGAGCGAGCTTGTTTTTTAACGCACTTCCTCCCAAAGGCGGTGCTTGCGGTCGCCAACTTTTTTCACGTACA
GGTGTTTTCTTCGCCTTCAGTAATAACCCCCACCGGGAGGGGCCCTCCCGAAGCTCCGTTGCGCTTTCATGATACCCCCCTCTCAGAGGTTCCGCCCCGG
ATGCATCGTAGCATTTCATTTCGTTTTCACTTTGAAAGATGCCAGCGACCTCACACCACCAAGCGCCACCTCCCCTCGTCAACACGACGCACCACCCAAG
CCCGTATCTCTCCATCGTCGTGGAACCATGCCCCGAGCCGCCGGTCACCAACCACAAAGTTATAGGCGACAAGCTTAACCGCACCCAATCTCGGGTTGTG
CCGGTGGTGCTGCTTTTGGCGGTTGTACTGGCCATCGGTGTGACTTCTCTCAACCCGCTATCCCCGAGCGCCGTCATTATTCGTGAGCAAGAGCCTGACG
ATGCCCACGACTTCGAGAAGCGAGAGGTGGAGAACTGCATGCCCTACGACATTCGTTCGACCGTTATGGGCAACCGTGCCGTGGTCGAGTGGTCCACTAG
GCGCACTTACATCCCCAACGTGAAGCTTCAGAAGCCTGATGACCACAGCCCCGCGCTCGCCAACCCGTGGCGTTCATGCCACGATGTCTCCTCCGATGTC
GAAGTGCGCTACCGTCGGCTAGGCGAGAACTACACGATGCTGGTCACTGGAGAAGCTGAAGAACCCTTTGCCAGGAAAGGAGCTACAACATACGCTACGG
ACGAAGCCACGTTCACGACCCACACCGCGATCCTCGACCTCCCGGATCACGAGGACACGCCGTACGAGTTTATTGTCGGCTCGATTTTCCATGGCTGGTC
AGCGATACATCGACTTGGTTCTAACCTTCCGTTTCACGGAGAGGAGTCGGAATGCTGCCGTCCTAAGCACGTGCACACGGCATACGGACTCAAGCCGGGT
AGCTTGGCTGTGCAGTGGATGACCAAGGAGTTTTGCGGAGAAGGAGCTGCTCAGTTGCAGCTGGTGGAAGGCTACCATGCCAACATCGAGGTGGAAGGAC
CGAAGGCTACACCCGTCACCGCTTAGGCCAACACCACGCTGTTTGAAGACAATGGCGAGGGACAGTTCAAGCGTTGGATCCACGTTGTGAGACTCGAGGG
GCTCAAGCCAGACACGCACTACACCTACGTTGTGGGCAACGCGCACTACTCCTCGTGGTCGATTCCCTATGTCACCAAGACAGGCCCTGGCCTACTGCTC
CCTGGAGAGAAGCCGAAGCCTACCAGATTCCTAGTCACGGGAGACATCGGCTACCAGAACGCAGCCACCTTGCCCATGATGCAGTCTGAGGTGGCAGAAG
GCCTTGTGGATGGTGTTGTGTCTGTCGGAGACTATGCCTACGACCTGCACATGGTTGACGGTCATGTCGGAGATATCTTCATGCAGGAGATCGAACCGAT
TGCTGCCAGTGTCCCCTTCATGGTATGTCCGGGTAACCACGAGACGCACAACATGTTCAGCCACTACTCTCAACGCTTCCGCCTCATGCCAAGCAACGAG
AACGAAGGCGTGCAGAGTGTGCACATCGGTGGCCACTCGAAGGACGTGGAGCCCAAGAAGGTGCCAAACAACTGGTTTTACTCCTTCGATGTAGGTCTTG
TGCACTTCGCGGTTATCTCTACGGAGATCTACTTCAAGAAGACATTTGAAGCGGACGGAGATATCATTGCTCGCCAAGAAGCCTGGCTAGAGCAAGATCT
CGCAAAAGTCAACGCAAACCGGGAGCAGACCCCATGGCTCGTGGTAATTGGGCACCGCCCCATGTACTGCACGTCCGACGACACTAACTGCGGTGACAAG
GCTGCTATGCTGCGGGACAGACTCGAGGACAAGCTGTTCAATCACGGTGTTGACCTGTACCTGTGCGGTCACCAGCACAACTACGAGCGAGCCTTTGATG
TGTACAAGTCCCAAACCTGGAAGCGCACGCACAACATGCGCGCAACAACTCACATTTTGACGGGAGCATCAGGGCAATATTTGGCGTCGATTATGCGGAA
GTCCTTCGAGAGACCCGCTGAGGAATGGGACGCCTTCCGAAACTCCATATTCGGCTACTCGCGGTTGCAAGTTGTGAATGCCACGCATCTACACTGGCAA
CAAGTTATGGCAGATCCCGAGAACCCGGCAGCGCGCGGGCACTACGGCGAAGTCATTGATGACGTGTGGCTCGTACAAGAGCACCATGGCAGATTCGAAC
CCATTGCTTCTGTATCATAAGTATTCGAGATGTATTAATGTGTAGTAATTTATAAATCCGTAGTTTTTGATGATACTAACATGAATATATGGTTTTGGCT
TCATAACGAATCAAGTCTCTCATGCTACCGGTTGGAAgtttgacgtgacgagggccttttcaaatacccgagatacatcgacaaattttcccaagatgtc
gagaattggtgaaagcatgtccgattgactttggatgaccgccattctgcttgacgtaccatcccactgaaaatacaccgagccacgcatcactatacgc
tgccccagcagtttgatagcaagcgaagaccacgattcctggctttcagagcccgccttgccaccaaccaagtgggggaacgcacgttgtactgtcttgg
cagtaattgttaggcttgtcgtagtggtggcgaccaaTGAGGTTGCTGTAGGCCCCTTCGCCATGTGCTCAAGTTGAACGTGGACATCCTCGAAACAGTG
CGAGATCAACATCCAATTCTTCAGTAGCGCCTCGACACCACAAGCCGACGCGCTTATCACGTCCGGTGCCATGACGCTTTCCAGGAAAGCCAAACCCCGC
ACATGTTCAGGTGCTGGAGGCGGCTTAAAAGCGCGTTGAAAGATATGGAAGTAGTCAGCTACAATACTCCACAATGACTTGTCTGTCGGAGCCCTGAGCA
CCTTTTTCTTGTTCCACGCAGCAAGTCGCCGGATTTCTTCTTGTAGTTGGGCGTTGGCGTCTTCAAGGTGTTCTATCAACTCGCGCTGCTTTTGTCGGTA
CTTCGCTTGGTTCAGTCTATGACGTTCCCTAAGCGCGGCAGTGATAGTTAGTACGGGTGTACCTCTTGCTGACCTTGAATCGAGCGAGATGGGGTTTGTA
CGTGTCTGACACGGCTGGTCAGGCTTTGCGCTGTCTTGAATTCTGGAGAAGACGCGACTACGAGGCAGACAGGTACGCGGCATCACGACAGACATCACCT
CTTCGCTGAAAGACTGGCTGTCGGGCGGCTGGAAAGCAGAGGTGACCATTGTTGTAAGCTTCGTTGCAGCAAATTCGATTATGAAGCACGACGTGGCAAT
CACTTCTTCACTCGCGTCAACTTTCAACATACCATAATGATTACCATGacttgttgattccgacaatatgtaaacatattgtaagctccgatattacatt
ttgaccattactcaaccaaactaatagatgctgattccgacaatctcaaccaacaatttccgcgtcaacccgagtgcaggcATTCCTGCTTGAATTAGAT
TAGAGCTCATTTGGCAAGATGCCTTGTGGGTGAAACCGCTTAACGGGACGGGTGGTCGCAAATTACACCACCACAAAAACACTTGGGCGACCTACGAGTT
TCGTGTCGCCGTCATCAACTCCAACGAAAGCGTTGGTATTCAAGACTGTTGGAACGCACACCGGTTCCAAGCACCTTAAGCACTTTAGCGCCACGAAGAA
TAAAATGAAGACCGAATTGATCTGAGCGTTAGTTACTCAATCTCCGAGTTTCTATCAACACTCACGGGTTCAACCCCGTTCCCATACAATGAGCTGATTT
CCTAGCTTCTCAGCTCCCTTCTCAACTTGCCGTTGAATCAGGTCTCAGATGCACATTCCAACAaagacacgctcggctcgttctttccggggctacaagg
ggcggccctcgacaccaagcgcgagagcgtccacctctgggtcaagaagaaggacaagatcatcgccatgtgtgaaacTGTTCGATGTATCCACTACTGT
TCAGGGCCAGAACACACGTTTGAGGTTTAGTGGATGCCAGAGCTCATTCAAGAATCTGCCCTCTCAGAGCAGAATCCCCGCCGTGTGATGAGAAGAGATG
CGGAGGCGTTCATGCGGCGTCTGAAGGAAGACACGGTGCTGAGCGAGAGCGTCTCGTCCGGGAGCATCGCGAGTACGTCGAAGGCACCGCGGACCGTGAC
GTCGATTTTGGCGACGGCGGCGAAGCCGCTGCCACCTTGCTTGCGCCGCCCCCTCCCCCCATCTCTGCGAGGCGATCCCGAGCAACTGTTCCTGCGCGCG
ATACGTCGAAAGCAAGCTATCAAAAGAAAAGAGCCCTGTCTGAGTTCTAAAATAGGCTAGCGAAGACGCCACGGCTGTTAGGGAAAGCACCGGTAGCATC
CCTCGATGCTGAGGAACTGGCGGAGAAAGCTGCAGCAGCTGAGTCGGAGGCGGACGATGAAGTTGAAGACTACGTTGATGAAGAAGAGGACATTCCGGAC
GACGACGTTGAGTACGATCAAGCAACCACACCACCCGCTACGCCACGAAGCAAACCATCTACAAAGAAAACGAAGGCTAAGATCACGACGACAGCGGAGA
AAGGGAAGCGCAAGCGTCTACCAGTGAAGAAGCGACCTGCCAAGCAGATGCGGACGGAAAGTCCTCACGTCACGCAAAGTGATGGAGGAAGCAGGTACGG
AATATTCCGCAGCGTCGATGTTGGATGCATACTTACTTATCCATTACTTGGTGTATTGCAGCCAAGAGTCTGATTTGAAATTCACCGGATTCTCATTACC
CACGCAGCAAGCATCAGCGCTTGCGCCACCTCTCGCGCAGGAGACTCTGCTAGCAACACCACCTCGGAGTGTCGCCAGGTTTGTTGCAACATGCTGTATA
TCCAGCATGTCATGAATCAGTGCACTAACCACATGCTGTATATCTATTATGTCGCGCAGGTCACTGGATATGACAACTTCTCCCGATGCAACAGTGGCTT
CAGAAACCTACTTCCAGATGTCGACAATGCAGAAACCGGTGACGCTTTGAATTCCGACTATGAAGGATCTAATGCTGATTCCACCGAATGTTTTCATGAC
TTGTTTTGCACTTGTGAGCGAAGTTGGGTCACGAGTAGTCAGTGGTGGTGAAAGTGAACCTACTGATACCAGTGCTGAAGCGCTATCTGCTGAAGATGCA
CTCCCTGCTGAGGAACCCCATATTGCTGCGAGTCCTGAGCCGCGACCACCATCCGGATCAGTAGCACGGCCGCGATTATCAGCTGCAGAAAAAAAATCGA
GCGCGAAGCTTAGAGCTGTTTTTCTTTTTTCTACCCCGACCGTTCTGGGTGGAGGTGGCGTGACAGACGAATCTCTACTACGACCAGGAGTTGGCAGGCC
GAATGGAGGCAAAATTTCAAGCACAGACTGGGAATAAAAGGTTGATATTGGAGCGAATTACAGCGAACGAGAGGCGCATGCACTCCGAAATTTTACCTCA
TGAAATTCTCCAGTGTCTTGGGTTACTGTTGGCACGTATGCTTTGTCCGCACTCGCGCCGCCTTTCGGATCACTGGGCGACCGCATCAGTTGGTGCAATT
CCGGCTGGGACATTCAGTCGTTTCAAGCCGCGCGAGCGTTTCGAGCGCGTCATGCGCAACTTGCACTTCTCAGATAATACGGCACCTGCTGCGAGTACGG
ATAAAGCAAGGAAAGTCCGGCATATTGTCATCACTTTGCATCGGACTTCCCTCAGAggctaccgtactccgtccatcatctcattcgatgaagcgatggt
accctcgcggagtaggtacaacccaatacgccagttcatcaaggacaaacctcatagctgggagaccaagcttttcatgtcgtgctgcgcgaagacatct
tactgcctacggtaggtGCATACGTCTGCTCATGAGGCAGGCGTTGTTTTTGTTTGGTTTACAAAGTCTCATATGCTGGATATGCTGTTTGTATCTGCTA
CGCGTATGCTTGATATTATGCATGTGAAGAATGGAAGTTTACTGTGGCAAAAGTGCACAAGGAGGCCCAGAAGAGAATGGTCCAGCTGATGATAGCTCCG
GTCCTGCTACTACTTTGAGAAACCTCAACATTGTACTCCCTCCGGAAGAAGAAGGTGTGTATCACGCAGTCGTAATCGACCGCTTTTACACATCTATCCA
GAGCCCGCTTGATCTTCTGGCGAGGAATGTGTATTCAGTGGGGACAATCTCGACGAGGAAAAAGGCTTTCCCCAGAGTCTGAAACAGGAAAAAAGCAAAC
GTCCAAGACACGTTGCACGAGATACCACCCAGCTCGTCGTGGCGAGATCGGTGCCCCAGTTGAGCGCTATTGTGCTGTTCGACAACACCGTCGTCTACAT
CCTGGGCTGCGGGGCCAATACTGCAATGTCTACTTGTGGTAATAATTACACATTCTCCACTAGCTACTAATACGACTAACGTTTATATTTATCAGACCGA
CGGCTGCCGCGCTCGCAAGTTCAAAGCGAGACGAtcccctgccctgccgcaatgcgagcgtaccattggtggatgggaggagttgatgtgcacgatcaac
tccgcctacagcgctattccctacagatgtccttgcggttccgcaagtactacaagaggttagcgctaggacgcattgacatggcaattgtgaacagctt
tatcgtctatcgcgaagctttcaagatgcgaggcgatccgcgtgctgaccatgCAACCTTCATCACACAACCGCACGCGCAGCTTCTAAATCTGGGGGAG
GCAGAGTTTGCAGTCGCGATACGTATGCTGAAGGTTGAGTCAAGAATTATATTCTGATTCTAATTGCTGCTGCGTTTGAAGGCTTACTCACCTGCCCCCA
TTGTGCCGACGCAAAGCGCAACAGCGCTGTTACCGGAGGCCACCGACTTgatatggataatgagtgggttgaggtgaacgggattcggaagcggcggcag
cggcagtgcaagatgtgcactatccgcaaacccgtcagcaccaagcgtcaggtgacacgcttttaccgtccgaagtgcagcagaggcttcaagcggtaag
tgcatcatggttgatatcaaacatggaaacgattgacacatgctcgatatcgtgctagtttgtatttgtgtgatagggtgcgtagcgatcactatccaac
aacaacttgacttgctttgcaatctggcaccagctttggcgaaacaggagcgagcgaccgcagcctcgctgtggtcgtggtatccaagtgaaagctcctg
ggaagaagcCGTCAAGTGCTGGTGAAGACGATGCCGAAGACGAAGAAAGAGGTCCTGCAAGTGATgacgacggcaccgccgacgaagagagggatccacc
tgctaccggtggagatgcgcaggcgggaggtgatggtgcggctgccgatggaggcggtgaagctcaggaagaagcgagtatcgcgactgctggtgatgat
gacgatgctcaggaggagacggctgaggaatgcaaattgcgagtggagactgatggtaaaacagacgagaatacaagtagtagtgattctttctacgaac
agaagcggggtagctacgtgagtaatcagctgctaatacttgcaattcacgcgatttcttatcaacttcaatacctatttactcaattgcagtcgttatg
cagacgtatatcaacgaaaaatggcgctatcagtaaaagggccaaaacgatatccgctctatcaagcttatcgtcctgaaatgtgattggagatgcttga
tatacagcttgtggcttcataaatggtacatatgacaagactttgaaccaacatccggacgacgttcttttttTTCCATACAAATTCCAAGTTAAGTCTT
TCTTTAACATGCTTGATGTCAAGCATGTGAAAAATAGTCTATGCAGCCAGGATTTGCCTCCGTACCGGGGGGGGGttaaacattaaggtcgaattcaaca
tgttctatacggtaATTCTCTGCCCCCACAAAAAGCATGATGATTTACTTTATTTGTGCCCACACAACAACGTTAGAACATTCCATGCAGCAATCACCTC
GCCAGGATCTTCTTCAACGCTAAGGTCGGCGTTATGTTTGTTGCGCTCGAACAACGAACGTTTTTCGTCCTTCGTACGTAAGATAACACACGTTAGTATC
GTACATTTTAGAGCTGTAAATAAAATTATACACTGAGCATTTTtgtgacgaggtccgagccaattctaggccaggacccatcagtcagaagcccaaaccc
tatcacgtaccgtccacaaatcacttgaaacgtggatatttcttgacccaagtctggtttttgtacagactttaagtggtactggctacatctggaaact
gagctctgcgaacgtcgagttgcagcgacccctgatccctaggtctgagatttgaattcagtctggggtctaaggtctgagattcgctctagaagccgca
gatctgagtttccaggcctcgagtcggcctccgggcagagagctgagccctggccttttggatctgtgatttggagccggttgcttaagtctcagctgcg
gtagttgctctttgaagttggcggttgccgcttggaaggtcgctctgaagggtcaccccgttgtggcttttcggcccctggtgtcgggcacacaagattc
ggcctgaccagtcgcctatggatccgggccaacgggagccacaggatcttggcgtcatccggattacacctgatttgtacccagagtaatcagtgtaatc
aggtgatgacagacctagtccgcccaatcccggccacaagatcctggcgtaatcaggatatcactgatttgcacccaggtgtaatcagtgtaatccagtg
atgactgacccagacaggccaatggaagggcgccaaggcagcgacgtgcattcacgggcgccgccaagccagtagcttagtgggtgtctcacccttgttc
aaggtgtacccaggagatgtttgcacccttacttgataggccatttgtatgtgcatgtgtatgataataatcagagttttttgccccgaagaccgcaagc
tgcggagttcgttttgcgccaacgggcgtgttgcttcacagggaccaagtccctgcccccggcgNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtcgagttcggaggcagctggtgtggccgacgcaagt
ctgggcccacagcgtagccttaggaagaaccaagtcaagggattgcaagagtgaggaacacacgcctcacccagcttgggatctgagatctaatctcaga
ttctgagttgagtggtctgagatcggggtctagccgcgaggctattccctgattttggagcccgcatcgccacaaaaatggtagtgtagtatctacatgt
ggtcttacatggcggggagctgctcgcgccacagagaagcggaaagcccagtgttgcaggagccgctcgtgcactcacagacgaagctgacaagccgtta
aacaagttcaacagagccgtaccggagtagcagtagccggcgacgttacctcggtccaacgatgcgcccgttatgttaagtaggaagaggtggtgcgact
tacctacgcctggaggtcgatttactacagtctcgcatttttatgtcttcgaattattttatctcagagatcgatctaagccctaaatccgagcgacaaa
atatctgcaaaccacaataATAGTGCAGCCAAAAAAGGCACTTGTTATCTTGACCCGACCTCTAAACTGGCTATTCACAGTACCTCTCCCTCCCAGCCAT
TCGCAGATAATCGAAAAAGATCTTACACAACTTTCAACCAATCACATCACTAGAAGATCTTTTTCATTTTCGAGGGGGAGGGGAGGATATTTTCCGTTCC
AAGCTCCGAACAAGGCGAAGGTGACCGAAGATCCGCCGCTGTATGTGCATGGCTGACAGACCCCGCGCCTCTAACCTAACCTTCTCCTCCTTTGTCTCCT
GCGCAGGTCGGTCCAGACACGCACCATGAGCAGCACCGGCGCCGGCTACGACTACTCGGCGGGCACGTTCTCGCCCGAGGGCCGCATCTTCCAGGTCGAG
TACGCCAAGAAGGCCGTCGAGAACAGCGGGTGCGACCAATAACAACCTATCTGCTCGAGGTTAATGGCCGAGGTTAACCTATATTGTTCTCGGTGCAGCA
CCACGATCGGCATCAAGTGCACTGACGGCATCATCATGGGCGTGGAGAAGACGCTGCTGTCCAAGATGCTGGTGCCCGGCACGCACCGCCGCGTCTACGC
CATCGACCGCCACGTGGGGCTGTCCATGGCGGGCCTCGTGGCCGACGGCCGCCAGCTCGTAAACCGCGCGCGCGAGGAGGCGCTCAACTACAGGAAGAAC
TACGGCTGCAGCATCCCGCCGCACCTCCTGGCCGAGCGCATGGGTCAGTTCGTGCACTACTACACGCTGTACGGCTCCATCCGGCCCTTCGGCACGGCCA
TCATGCTCGCCGGCTACGACCAGGACACCAACAAGTCGAGTCTCTACATGGTGGAGCCGTCGGGAGTTACCTACGTGCGTGCGCAGATCCAGGCGGCGGG
TAGCACTATGTCTAGGTATCTTTATGAAGCTGATTGGGTTGCTGTGTGTGTGTTTGGTGCAGAGCTACCGCGGCTGCGCGCTGGGCAAGGGCCAGCAGTC
GGCCAAGACAGAGATCGAGAAGTACAAGCTTTTCGACATGACGTGCCGCGAGGCCATGAAATACGTTGCCAAGATGTACGTGCAGGCGTGGCAGAGGAGA
CGCATTGTGGTTGCAGTGGATCTAACGGGCGGATTATCTTTCTTCTTTTTATCAGTCTAAACACGCTGCACGATGAGGTGCGCCACCCGTTCGAGCTGGA
GCTGAGCTGGATCTGCGAGGAGACGAAGTGGCAGCACCACCTGGTGCCGGACAACCTGCGCGACGAGGTGAACGAGTGGGCCGTCCAGTCTATCAAGGAG
GACGAGATGGCTgacgacgacgacgatgacgacgaGTAAGCTGCAGGATCTTCCCACCTTTGAAGCATAGCGGTCGTGTAGTGCTCTGGCTGAAAGCAGC
GGATCGTCTCCTGACGAGAAGATCGATACGAGCGAAACAGTCTTCGAAATATGCTGCATAGGCGCAATAAAGACGATGAACACTTGACAGAGGCGTCCGT
ACCGTTTGAAAAGTTGTAAATCTAGCTTGCGTGCTTTGAGCTCGAAGGAAAAAAATCTTCCAACATTGAAAAGTGGCGTGATATCCGTCGGCGTTGCCCC
TTCCACCGCTTGGCCGCAGCTCCGATAACTTCTACCGATGGCATGTCGACACCTGTGTGCGCCTTCCTGCAGCAGGCGGACCTCCGTGTAACGCAGCACG
GGATAAAAGAGACGAACGCAGTAAGAGAATGGGGAAATTGATCCTTTTATAAAGTGCTACACTCGACAATAGACTACTACACGCATATAATGGAACTACA
CACTCCCTCCCCTCGCCGATTCGTACTCGTACTCTCGTCTCACTCTCTCTCTCTCCTCGCAGTGCTGAGGCACCTTAAATAGTAAATACTCCACTGCTGC
TGCTGCGTGTCCCTCGCCCCGATCAGCTACAGGACAAGCTGGCGGTCGAGTCGTCGCTGAAGCTCAAGGACGCGAGGCTGTCGCTCTCGCGCtcgtcgtc
gtcatcgctctcgcgctcgtcgtcgtcatcgctctcgccctcgccgAAGAAGCTCGAGGACGAGCAAGTGCTTCCGAgcggcgcgtggcggcgcgcgggc
cggcgcATGGCCAGCATGCGCAGGTCCATCTCGCGGTACATAATGACGCTCCACTTGCACTCGCCCGAGCAGTAGCAGTCCACCTGGTCGTCGGGGATCT
GCAGCGAGAAGAAGGACACGCCGCAGTTGCTGCACACGAGCGGCAGCCCCGAGACGCTGGGCCGGCGCTCTCCGCCGGCGCAGCAGTCGTCGTCGTCGGC
CTCGTCGTAGGGCTCGGAGGCCGCCATGAGCGCCAGCACCTCGAGGTCCACGGCCTCGTCCATGGTGCGCGCCGAGCCGTCCGAGCGCGCGTCCGCGTCC
TGCGCCGGCTTGCGGCACAGCCAGTCGCACGCCAGGTAGCCGAGGCAGTCGCCGCCCGCGCCCGCGCTCGCCTGGGACACCATGTTGAAGCCGGCGGGGG
TTTCCGTGGCGGCAGTCTGTCGGGCCGCGGTCGCGCCCTGCTCGCGGCAAATTGCAAAGTGACCGAGTCCTGCTTGGCCCGAGCGATCTTTGTTCCGCTT
CGTATAGCGCCGACTATGGGGACTGGGCTTCGGGCGGTTTGCTcgcgccgagcgccccccgtgccgctgccgtgccgcgccctgtcgcccagcgccgtgc
GAATGTATGGCGGGATCCGCTGCGTCCGCCAAGGGTCGCCATTTTAACGCGGGCGGGCCAATCGCAGCCCGCGTCTGATAACGTACCGTACGTTCCGCAG
CCGGCGCAGAAACGGGCCGCCGCCGCCCATTGGCCCAAAACGCGTTTTTCGAACAAATTGGGGGAAAAACGCGCGCCGCTCCGCCGCGAATTCAAATTCA
AAACCAGAGGCTCGGCTCGGCTCGCGGCGGCGATGGCGGTtgctgctgctgctgctgctgcCAGCGGTGCTGCTGGCCTGTTTCCAAGCGCAGCCAGCTA
CGCGCTGCGCGTAggcggcggcggcggcggcggATATATGCAGTGCCGCCCGCGAAGATCTTCCAGCCGGTCTTCCAGCCGGGCGTGGACAGCCGGCGCC
GGCAAAGCCCTGTTGCGAGCCGTGTCTCGCCGCGGTGGGTTGCTGCGGGGTCGTGCCGCCGGCGTGGTTGAAGTGAACACCCAGCTGGGCCTGGCAAATT
GCCAGGCCTGTGGCAATTCGTCAGCGCACTGGGCGGGGCGTCCGCGGTCGGCGGACTCGGTTTCCCCGCCGTTTTGCGCGGTTTCCCGCGCATTTCACCC
CCGGCGCCGAGTCAGCGGAATCAGCTACGGTGACGTCGCGCAAAACGTCTGAGCCAAAGTCGGCTCGTGACGCACAGCGCTGACCCAATCGCGCGCGCTG
CTTGGGGCCTCGGTCGGAGCTCATTGGACCGCGCGGCGCCAGCGCAGTTTCGAGCGCCGAACTTGCCGCAACGGCGAGCCAAGCGCTCATGAGGCCGGTC
CAGCTTCCATGGTTGCCCTCCAGCGGCGCGCAATGCCGCTCGCACGACCATTATCGAAACCGGGTGAGATAGCGCGATGGCTTCGCTTTTTGCCGGCGGT
AGACAAACGTGGAAGAATGGTCCCGCGTGGACCGCTAGGCGGACGAGGTTCCGCTCACAGACAGCCCACGGCTAGGCCTTTGCATTGCCGGCAGTGACGA
GAACCAACGCCACAGCGGTCGTGTGCTCATAACAAACGGTGGCATCACCGGCAAGCCATCACAAATCAACCCATGCGTGGGGCAAGTCTTCATTTGACTT
GACACGCCTCGTGAAACGCATGCGGGGGCTACTATGTTCACCCAAACCGTCGGCAATGTGCTCCTCTGACTAAACCGTAGTCGCCACCGAGCCGCACGCT
TGCTACAGCAAAGCTTTCGACACTCGGGAGCGCATGTGGCGCCGCGCCCCGAGCCGAGGAGACCCGCCCGATGCGCGCCATGTGGCTCGCATTGCTCGAC
GGCGACCATGAAAGATCGCGCGGGTGTGGTCCACATCTTCAGGATCAGGTTTGGCGGGGGTGTCGACCACCCACAAATCATCTTGGGCGGGCTCTGGCTT
CCGATTATAATAGCGCGCATTTTTTCAAACGCGCCATACTGAGCGCAAGAGGATCGAGTATTAGCTCAGACAGAGCCTGCGAACCATGGCGACGCCCAGC
GGCATGTCCGCTCCGAGGCCCAAGGCGCGCAGCACCAACCTCACGCACGAGCAGAAGCGGCTAATCTGCCTGCACGCGCGGCAGTTCCCCAAGACCACGC
AGGCGCAGCTGGGCCAGTGGGCCAAGGAGCAGTTCAACCTCGAGTATGTGCCGTCGCAGGCGGCCATGAGCTACATGCTCAAGAAGCGCGCGCAGTTCGA
GCTCGTGTCGGGCGAGGGCCGCGACTACAAGAAGCTGCGCACCGTCAAGTGCCCCGAGGTGGACTCGGCGCTGGCCAACTGGTTCCTCTACTGCCAGGCG
CGGCGCCTCAAGCTGCCGGGCGACCTGGTGCGCCACAAGGCGCGCGTCTTCTACGAGCTGCTGGCCCCGCAGCTGCCCGAGAGCGTCACGAGCGCGCCGC
CGCAGTTCTCCAACGGCTGGATGCACTCCTTCATGGGCCGTCACGGCTTCTCGCTGGGAGGCGGCAAGGGCAGCAAGGGCCGGGCGCCGCGTGCGCAGCA
GGACGACGTCGACGGCAGGCCCAAGTTCGCGCCGGAGACGTCGGTCATCACCACGCCCGACCACATCAAGACGGCGGTCATGGGCGTGCCGCCCGAGAAC
GTCTACTGGCTGCACGAGACGCGGCTGTTCTACGCCATGAGCCCCGACAGGCAGGCGCTGCCCACGGGCCACCACCCGGAGAAGAAGCTGACCATGTTGC
TGGCGGTCAATGCCGACGGCAGCGACAGACTCAACCCCTTCTTCGTGGGGCCGCACGCGCTTCCCGCAGACGTTGATGTAAACGCGGAGGACCGGCAGTA
CCAGTTCGCCTGCAACCACAAGGCCTGGGTGCCGCCCACGATGCTGCGCGACTGGCTCATGGCGCTCGACTGGCGCATGCGCGTGACCAACCGCCAGATC
GTGCTCATTGTCGACTCGGTGGCGGCGATGAGCGTGCAGAAGGCGACGATGTCCAATGTCAAGATGCATTTCGTGGAGCGCAATCACGCTGGAGAGCTCT
GTGTGCGAGCTCTGGAGATGGGGATCGTGGCGGCGGTGAAGCGTCGATACCGCCACCAGCTCTTGGACTTCGCGCTCGATCGACGAGAGGAAGGCCAACT
CGATATCTACGATGTTCCGTTGCTGAAGGTGGTGGAGTGGGTCACGCACGGGTGGCAACAGATCCCGCGATCACGGATTATGGCGAGCTTCGCGCATATT
GGAGTTATGGTGACTACAGAGACAGGAGCAGAGGTTGTGCCGGACAACCGCATCGATGACAAGCTGGACGCGCAGATCCAAGCGTTGCTGAAGCGTCTGA
AGCTCGTCAGCCCCATGCGGCTGATTGAAGTGGTTGCTCCTACTTCCGAGAGGGCATGCGACGAAGACCTCACAGACGCGGACTTTGCCGACTCGGCGCT
CCACGCTACACAGGGCACGGTGGGGATGCAAGTTAGTACGGAAGATCTCACTCGCCACACGATCACACAGGTGGGAGCAGGCTCGTCAGCGGAAAACTCC
TCGGGCTCCTCGACACCGTTCGACGCGCAGGGAGGATCGCGCTCCGTTGCTCCCCGTCGCAGCAGTAACAGCACTGCTGCCAGCAGTTTTATCAGCGACT
ATCCTGGCTTTGACCAAGGCTACCCCGGTTCGTTGGACGACACTTGGCTGTCGTGGACTGCAACGCAGCGTACTGCGACGGCCCCCGTCCGCCAGCCTGT
GAGCGACTTGGAGGCCGTGCAGACGACGATCCGCCTGGCGACCGAGATGAACTGCGACGCCGTGGTCATGATAGAGCTCAACCGCATCCACGAACAGGTG
GCGAGCCGCGACCCGAGCTCCTCCAGCTCCACGGCGCTGACTGCTCCAGCTCAGCCGCCCTCGCGCAACGCTGGCATCTGCCAATTCCGCTTCGGAGCCC
CCACTCGGCGGCTGCTGTAAGCCTGGAGTCCAGTTGACCAGCACGGGCTTGTTCGTTATCATTTTGCGTGACACCACAGCAGGATAGTTTCAGTGTAGCC
ATGTCCGCTTCAACTTGCCTATGATTGGCGGAAAATCCGGAGAAAAGATTTTCTTTTCTTCGAGTCTTCATCCCAATCAAAACATTTAGCGGCGAAGAAG
GCACAGGTCTCGCTTCTCCTTGCCTGTGCACTAGCGAGCGACACAGCAGTACACGCAGCCAATATGTCACACCGCAAGAAAGTGCTGCTCAAGCTGATCA
TCCTGGGCGACAGCGGGTGCGCGCCCTCTTGCTCTCATGCTTGATCTGCAGCCCTCTCTGACCCGTGTATCATATCTGTAAATGCGTTGCCAGCGTGGGC
AAGACGTCGCTGATGAACCAGTACGTGAACCAGAAGTTCAGCAACCAGTACAAGGCCACGATCGGCGCCGACTTCCTCACCAAGGAGATCATGCTGGACG
ACAAGCTGGTGACCATGCAGATCTGGGATACGGCCGGCCAGGAGCGCTTCCAGAGCCTGGGCGTGGCCTTCTACCGCGGCGCTGACGCCTGCGTGCTGGT
CTACGACATCACCAACCCCAAGGTGCGGGGAGCTGCAGGGGAGGTGGAGAGGTTTAGACGTCGGGTGTGCTGACTGTGTTGCTGCTTGCTGTGCTGCAGT
CATTCGAGAAGTTGGACACGTGGCGGGACGAGTTCCTGGCGCAGGCGGGGCCGAGGGACCCGGACGCCTTCCCGTTCATTGTGCTGGGCAACAAGGTGGA
CAAGGAGTCGGAGCGGAGGGTGGGTAGATCTGCGGAGGCAGTTGAGAGCAGGGGAGGAGGTTGCTGATAATTGGGTTGTCTTGTTGTGGCGGTGGTGCAG
GTCCAGAAAGAGAAGGCACAGGAGTGGTGCCGCTCCAAGAACGTTCAGCAGGTAGGGGTTGAAGAGTTTGCTGTTGGAGGAAGGTGTGTCGGTCGGGATA
TTGATGCCACGTGATATATTGGTGCAGCCTATTCAGCACTTCGAGACGAGTGCGAAGGAGGCGACAAGTGTGGAAGAGGCCTTCCAGACGATTGCAAGCT
CAGCGCTTCAGAAGGGTCAAGAAGATGACATGTACGTACAGCAATGATTCGCTACGCTGAAGTTGGAATACTGTGCGGTGAGATGACTTGATGGTTGTGG
GTTGATTTTGTGTTGTTGCTGTAGCTACGTTCCGGAGACGATTGATCTTAGTGGCACATCGTCGAAGCGCGAAAGTTCTTCATGCTGTTAAGCATCATGG
GCCGTGGGAACTGGCTCGGCGACAACGTGAGTGACAACAAGGTAACGATGGCGTGGAAGGTGGTGACCAGAGAGCAAATAGTAGAGGAGCTGGCCTGGCT
AGACGAATGTAGCTCTGATCTCACTATTGCTGGAGGAATTCATTTGTCAGATTTCTTGGTTTCGTCCTTTGGTGTTGGTTTTTGTTTGCTGTCAGAAGAT
GCTAGCTTCGCTACTGGCGACGGGTGCTCGATTGCAGTTTTAGTTGAGCCTCTCAAAATTCCTCCAAGAGATAGAGGTGGTACTTGGGTCCGCTTCTTCT
TTTGCTTCTTCAGCGCTAGACGCTCTGCTTCCAGCTGCTGGCGCCGAACTTCGATCCGCCTTTGTACTTGAATCCTTCGCCAACGGCAGTAAACCTTGAG
CTGCGCTGCAAGTTCCACGGCTTCCTCGATATCTCGAGTTGGCACCGGTTTTGGAGGACCGAACTCATATCGACCCCATTCCTTTGGATCCACCTGCTGT
TCTTCATCGGTGGCGATCATGTACTTACGAAGCTGCTTCTTGCTCGTCTCACGAATTGTGATTTCTCGCTTCAGGAACGTCAGCTCTCTGGCAACAACGT
TTGGTTCCTGTTCCCGATGGCGACGCAAGAAGTCCTCAAGGGCTAGCTTACTGAATTCATCAGGTAAAGGCAAAAGGTTACGGATGTAGGGTAATGCTTA
CCTTTCGCGTGATCAACTGGACGAGGCCCCCGATACTTCCTCACGGGTGACGGTGGCGATGTGATAACCTCCTCGTTTTCGGGAACTGTCACCCTGGCCT
CCTTGGCCATGTACTTCCGAAGTTCCTCCTGCTGGCGGAGTTCAACCTGGTCGCCATGACAGTCTACACAGAGGTAATCCTGCTCTGGGTCTCCGAGATC
GCCGCAGCCTGCGCGGCATTGAGCCCTCACGTGGGCACTCATGCTGATGCCTTCAACGAAAACACGGACCAAATACACGCGAGCCCACCAGCGTTGTAAC
TGCCGCAATGCAATAAAGCAGCTCTCAATTTGGACACTTCGTCTTAATGCTGCATGGTCCTTTGGCTGCACGTCGTCTCTAATGCGACTCACTGGGGGAA
GAAGCTACGGCGCTTTGGGGTCTTGCAAATAGAACGGGTGGAACGAGATCAAGCCGCTGCTCCAGGCAACACTCAGCAGCGCTCCATGCTTGAAATTCGA
GGCAAATGCAAGCTTCCGCGGTACGCCGGCGTTAGGAGGCCCGCGCAAAAGGCCACTGTAAACGTATCCATGTTAGTACATGCGCTTCGATAACTGAAAT
GAAGCAAGAAGCCACAAACCTGCGTGTGAAAATGAGGAAAGGCTCCCAAGCCACACTGAAAATGGCGACCAGTTTCGAAGTACCAGCTTGGTGGGAACCC
ATGGCCGTGGTCCTATACGTGACTGCTACCCTTGTTCCACTCGGGTCCCAAGCGATGTTCTGAACGTTGCCGCCAACAATGCTGAGATTATGAACAACAA
GTAGTCAGCCACTGAGCAACGACATTAAAATCCTAGCGATAACTTACGCTGAGGTGCTTCGGTCGAGCGAAAACAGCTCCTTCTCATCGAAATCAAGAGC
CGGTGAACTAATCTGTGCGTCTACATCAACCAAATCATAAGCAAGTAAGTATTTGTTTCCATGCATATGAAGTCAACAGCGTATCATACCTATCGAAGGA
GGGCAGTCTTGGAAAATGTACGGGTACAGGAGAGCGCTATTACGAAGCGCCACGAGCATGCACCGACCGTCGCTCGACCATCCGCAGCCCTGCAATATTA
AGAGGAAGAACGGCACACTGAGTACAGCAGTAACGAATGTGCTCACACTCACTTCGGTAGCATAACGTACCCCAGCCGCAACCTCCCACGTCTCCCTCTT
CCACGTGAGAGTCTCCCACATCAACGACACGCCGCTTCTGAATAACGACAAGCACATACACACAAATCAGCAAACAGCCCGGCTTCGGCAAAACCCACTA
ACTTTGCACCTCTTACTCTGTGGTCACGAATAAATACTCGCCAGTAGGCGACCAATGCAGCGCCGACAGCTTGTACGGGCTCTGCAGCTCGGTCTTCCTC
GAGAAGACAGCGTCGAACACAATCACCGCCTTGGATCCCTTCCCGAACGCCGCCAACAAGCTGCCGTCCGCATTCCAGCACACCTGGCTGAACGGCGCGT
TGCTCGGGTGCTTCAAGATCTCCAGCAGCACAGGCTCTGCAAAAAAAAAAAGAAATCAGCAACACGTCACCACCAAAGCTCAGACCCACCCCACCAACGC
CGCACCTTTCTCCTTCGGCGGCACCTTCCACAGGAACACGCCGAACCTGCAGGCCACGGCCAGCGTGTCGCCCGTGAACTTGCCCCACTCGACGCTGCCC
ACGTCCACCTGCTTGGCGTGCTCCAGCACGCGCGCGTCCCACGTCGCGCTCTCCACGTGGTAGAGCGCCACCACGCCGTCCAGCTGCGCCACGGCCAGCA
GGTTCCTGGTCGGGTGCCAGCTCAGGTCCACGATGCTCTCGCCGGCGTCCGCCGCCAGCTCCGCAGGCTCCAGAGGCTCCAGCTCCTCGTCCTCCGCGCC
CGTCGCGGCGCGCAGCAGGCGGTGCGCGGCGCCGCCCGCAGCCTCCAGCGCCGCGTTCAGCAGCTTCAGCTCGTCGTCCAGCAGGAAGCTGCGCGCGCCG
CGCAGCCCGCGCTTGAGCAGGCGCAGCGCGCCCGAGTCCAGCCCGTCCTCGTCCTGCTCGTCGGTCAGCGACTCGCGCTGGCCGAAgggccgcggccgcg
cgctggccacgcgcgccggcgggAACACACATCCGCCGCGGCGGATGAACTCGTCGCCCGCGTGCGCGTCGTCGCGCTGCGAGACGCTGTAGAGCTCGCC
GTGCAGCTCGCCGAGCGTCACGGCGTCCTCCTTGGGCACGACCCAGGTCATTGGCGAGTATATGCAAAATGTGTACGGATGGTGTGGCGCGGAGGTGTCA
CTGAAGCGAGGGAGAGAAGGTAGTGACATGATACTTTGCCTTTGGACCCAATGCGGGTGGAGGTGGAGGTGGCGCCGTCCGCCGGCATCTCCAGCGCCGC
GTACGTGTCGCCGACGACGTTTAGGAGCTTGAATGCTGCGTGGGGGTGCTACGTGTCGCTGCGACGCTGTGGAATGCATCGAATGCGCGTTTTTCGACTG
GAAATCGACGAGAAACTTGAGGAATACGGAGCTGTCAAGGTCCGCATCGACCACTGGCCCGAAGGAGACACAGAAGGAAGCTGCAACGCAGTGAAAACAG
GAGGTGGAGTGGAGGTGGAGTGTATATCGCCATCGGAAGTAAGAGTGGTGCAGTACTTGGCGCTTGCGCCCGCGGGCGACAGCCAGCCGAAGCTGGCACT
CCCGTTCGTGCGGAGCTTGCTGCGTGGACGGATTCTTAGTGGACGAGCTGGCTCCATTGCCCTGCAAAGTGACGGACTGGATTACGGTCGATGGACGTAC
GAGGCGTTCTTCCGTGGACGCAGAGCGGAGGACGGTGCACTGGAGTTTGATGGCGGAGTTGTGACGGATCAAACGTTGGTGTTGATGTTCCCGTCTGCTT
CGACTGCATCGTCGAGAGGGGAACCCAAGTATCAGCCGGTTGGAGCTCATGCGAGAGGGTTTAAAGAACTGGTGGCCATGGCTCTTCGTGGAGTGGAGAT
GCCGGGCGGTGACGATGCACATGGAGAGGCGAAAACTATCGCTGCTCCTCACTCGTTGCTGCTGCATGCATCGAGTGGCGCCGGAAAGACGACGTTGGTG
CATCAGATCGCAAAGGAGCTGCTGGCGAACTTGCTTGTAATTGACGGTGGATTGTTGGCGTCTCCACAACTGAGACTTGAAGATTTCTTCTCGGTTGCCC
TGCGGATTCAACCGTGCGTGCTGCTGCTCGAGGACCTGGAGTTGCTTTTCCCGATGACGCTGGATGAAACCAAGTACACGCTTGTATGTCGACTCGTCAG
TTGTCTTGAGAGCATTCGTAAGTTTGCTTGTTGTGTTGTGTTCTTCTTGCTATGAACTCACCGCGTTGAGGTATGTTACGCAGAAAAATCGGAGTCTGTG
CGGGTCGCTGTAATTGGAACTGTGTCGGTACTCGGCACTCTCCACTCAAAAGTGCGACAGTTGTTCACTGAAGAAGTTTTTCTCGATGTAAGTGGGCTCG
CATATGCTATCTGAAGCTCCCAGGCTATCGTCTAATCTAGAGTGTATGTACTTTCATAGGTTCCTGACAAGCAATGGACATTGGATTTGCTAACGTCGTT
GCTTCCGTCGTCGAATACACTGCGACCCGAATTCCTGATGTCTTTAGCCGTCCGATACGGCCAGCGGCCAAGCAACATTGCCGCGATCGCCCAACAAATT
GGCGTACGTCTTACCCAAAGTGACAACGAAGATATAAGTGTGGCAGCACTTGAATCAGAGATCTCTGCAACTGCGCGCAAGATCTCTTCCACAAGCAATG
GGGCGGATACTCTAAGTTCCTCTGTGCCTGACGTGTCGTGGGACGATATTGGCGGCTTAGAGTGCGTCAAGCAAAACTTGATCGAGATGGTGGTGTGGCC
ACTGGAGAAGCCGCAAGTCTTTCGCCGCATGGGAATCTCGCCGCCATTGGGCATGGTGTTACATGGTCCTCCTGGTACAGGAAAGACTATGCTTGCCAAA
GCAACAGCGAAGGCGAGCGGTTGCAATTTCTTGAACCTGGCAGCTAGCGACCTTATGAAGGCTGAGATTGGTGAGAGTGAGAAAGCAATTACACGCGCTT
TCGATACAGCCCGGGCGCTAAGTCCGTGCATGATTTTCATCGACGAATTCCAATCACTATTCGGCAATCGCTCAACAGCCGGACAAACAACATCTCGGAT
GATCTCACAGCTTCTTATGGAGCTTGATGCTGTGAAGGCCGTATCTGACGACAGCGAGATGCATAGCAACACGACTGAACCTCCCGCAATGGGCAGCATT
TCAACTGGCCAAATATTTGTTCTTGCAGCAACCAACGCTTTATCTGCAATTGATCCCGCCTTCCTCCAACCAGGTACACATTCGTGATACAAATCTGTCC
GTTGACTGATTTTAACTGGCGTGCTTGACTGTATTTGGCGTGCCCAGGCCGCTTTGAGAATGTTGTTTATGTTGGCTTGCCCAACGCCAGCGAGCGCAAA
TCCATTCTTGAAATTCAGCGCAGTAAAATGCCATGGAGCCAAGATGTTGACTTCGCAAAGCTCGTCGAAGAAACTGATGGCGCTAATGCGGCATCTTTGA
TCGCGTTGTGCCAGTCTGCAGCAATCCAGGCCATGCAACGGATACCGCCCAACGCCCCAGTGGACGAACAGGTACAAATTTGGCAGCACCATTTTTTACG
TGATGCTATCGACTGACACGAAGCTTGTGTTTGGTACAGTGCATCGCAATGGCTGACTTCGTCGCTGCGTTAGCAAAAGGCAACTTTGATTTTCAAAAAT
CCGCTTAATAGACGAAACAAAGCATTTGAAGAGGAGAACCTCAGCAACGGAAAGCAATGGCGCCGTTCATTTATCGGAACCGTCATCGCCAGACTATTCT
CTAAGTAGCAAAGCTCGCGTACGCACGCAGCGCCGTTTTGACGCCTGGGGGGAACTCGAACAAGGATAATTCGCCTTGAAATACCTCCGTGATGCGATAA
ATACCGCTGTCGATTCCTGTAAAATAAAGGATCGCGGGTTAGCCCACCAACTTTACACTTGCAACCAACAAGCAAGCAAACAAACCTTTTGCTAGAGCAG
TGGCTTCTTGGACGTAAACATCATTAGTACTGCTCTCCTTCAGGCACGTCTCCATGTACGCTTCCAGCGCATTGCGGCACTCCATCAGTGATGAAAGCAC
TGCCGGCACAGTGTGCTGTGGTATACAAAAGTGTGCGAGAATGATTAGTATAACAGAGGGTGGCGTTCACAAAAGCACTTCGACACATACCTGAACATAT
CCCTGCTTGTCTTCTGCACGCGATGCGCTCACGAGGTGGCACAACAATGACTCGGCAGCGCGAACGACCTTCGCACGCTGGAACACGCGTCGGCGTGCCT
CTTCCATCACAAAGCGACGAATAGCAAACTGCAGCTTGGACTCGACGAAAAACCTAATGGGCGACTTAACACTTGCGGCGGAGATCCGAAGGTTCGCTAG
GTGCGGGTACTGGTGAAGCAGGAGCAGCGGGTGCGCGTCCTGCTGCGAGTTCAAGAAGCGCACCAAAGAAGCGACGGACTGCTCCAGAGCCAACGCACCC
GTGGAAGAGTTGTCTCCAGCAGATCCCTTCCTCTCTGTTAGCGTGTTCAGCAGCTGCACCATGAGCGTAAATGCATCGACCACCGCAGTCGTCGAGTTGA
ACAGCGCATTCCATCGGCCCCGAGAAGTAAACAGCGATTCTCGTGCAGCTGCGTCAAACTTGCAGCCCGTGAGCAGGTTCTCGAACTTGAACAAGCTGTC
TAGCGTCTCCACGTCCTCCGCATCCGCAGGGGCCTTGGGTGTCTTCTTCTCCGAGATCTGTCTCACCGCTGCGCTCATGCGCTTGTGCAGACCCTGCAGG
TACTGCTCGTTCAGCGGCGTGCTGATCTGAGGGTTGGCAGCAACCTCCGTGGCAAAAAGAGCAGTAGTAACATTGCCCTCCTTGGGTTTCACGACCGCCA
GCGAGTCCCACAAGTTGTTGCTGTCGCCAAACGCGCCGCCCAACACCTGGTAGCTCGCGCGGAACAGCAGGATACGGAACACCGACGCCGCGCTGAGGAT
GGCCAGGTTCTCCAGCACGCTGCTCGTGATCTGGAACGTGACTCTGGACGCGTGCAGCGCGAAGAAGCCGCTCTCTGTCTCCTGCATCTTTACCTCGTCA
CCACTGCCGAACAGCCAGCTCAGCGCGCGGCCAGCGACGTACACCAGCACTCCGCGCCTCGCTGCGCGCACCACGTCTCTCTGCATGGCCCGCACGAAGG
CCGCGCGCGGATCCAGCACGAACGGATCTTGGGCCAAGCTCGTCTCCACCGCCACGAAAGACGCGAAGGCCACGAGGCCGCCAGCCACTGCGAAGGAGCC
GAAGTCCGCCGCCACCTGTGCGCTGGACGCCATGCCGTAGTACAGCGCCAGCTTCCACACGTACGAGTGCAGCACGCACAGCAGCAGCAGCACGGGTAAC
TGCGGCTGCTCACGCGCACGCGTCACAGCGTCCACGGCGGCGCACACGGCCGTCTGCAGCCCTCCGCGCGTGCTGGCGACCGGCTCGGCAGCAGCGCGGC
GCGGCGTGGGCAGCAGTGCGAACCGGAGCGTGAGGTGCGCAACTGCAGCAGCCCACAGCACGCCGACGACCAGCAGGAACGCCGTGAAACCGGGAAATTg
cagcggagagagcagcggcagcgacagcaacagcagtagcggGAAGACGACGGCGCCCAGCGTCGTAAGCGCCACCGCGCGCAGCGTCTGCTGCAACCGC
TGCTGCAGGTGCGGGTAGGGCAGGTCCGAGACGGCGGGAGACGCCGCCGCGCCGCCCGCGTACAGCCGCAGCAGCGCGTACAGCACCTCGAGCGAGTGCG
AGAAGCCCATGATGGTCTTAATGGCGGGGGATCTATGGTGGTGGTACACCGGTACAACACGCTGCAATTGGTGTTTTGTACATGATTAAATGGTGTAGAC
CACTGTACGGTATGTGCACCACTGTGAGGCACCACATAAAACATGCGTCTGTCGACGCGCGCGACGTCGCCGCTCGAACCTAATTGAAGTGCCTGAGGAT
ACTGAGACCATGCAGCTTTGCGCCATCACTTGGCAATTCGGTCGCAAGCGCACGAGGACTCAGCAGAAGCTTTGGTTCTAGTTGGCATGTGGCGCCGCAG
CGGCTCGGCGCTGAGCCAGCGCCTGGCGCTGAGCGAGGAGGTGGCGGAGGCGCTGTACGGGCGCGCGAAACGGCCCGTGGTGGCGCTCGAGTCCACCATC
ATCTCGCACGGCATGCCGTTCCCGCAGAACCTGCAGATGGCGCAGCACGTGGAGGAGGTCGTGCGCGCGCACGGGACGTGCCCGGCCACGGTCTGCATTG
CCGACGGGGCGCTCAAGGTGGGGCTGGGCGAGCGCGACCTGGCGCAGCTGGCGGAGCTCGGCGCCGGCGCCAAGAAGTGCTCCACGAGGGACATCGCGGC
CGCCGTGACGGACAAGAAGGTGGTAGGCGCCACCACCGTCTCCAGCACAATGTACGTCGGCTATTG