Description :
From Genome Similarity Track
Location :
contig_130:65091- 67888
Transcript NameFunction/comments
g11551.t1hypothetical protein

Sequence
2797 bases(100 bases per row)
TCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTC
CGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCC
GCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCG
TCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGT
CGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCA
GTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCT
CGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGT
CTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTC
GGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGG
TCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTC
CTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGC
TTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGCTTTTGCCCTCCGTCACTCGGTCTCGTCCACAGTCTCTCCACGACTCGGTCGTCTCGGTCGTCTCA
GTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCT
TGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTT
CGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTC
GTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGA
CGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGG
CTTGCGGTGCTTCTTCGACTTGGGCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCG
ACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGG
TCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCG
GTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACC
GTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCG
TCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTG
CTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTC
ACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCT
CGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTT
CTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACC
TCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCT