Description :
From Genome Similarity Track
Location :
contig_55:65086- 66896
Transcript NameFunction/comments
g11453.t1hypothetical protein

Sequence
1810 bases(100 bases per row)
AATCAGATTGTGGTGATTGTTGGAGAAACTGGGTCGGGTAAAACCACGCAGTTGACACAGTACCTACACGAGGAAGGATACTCTAAGTTTGGCACCATTG
GATGCACGCAACCGCGTCGTGTTGCAGCAATGTCGGTGGCCCAGCGTGTCAGTGAGGAAATGGATGTGACTTTGGGTGACGAAGTGGGTTACGCTATTCG
ATTCGAGGACCTTACGTCGGACAAAACTATTATCAAGTACATGACGGAAGGTGTGCTGTTGCGTGAATCGCTGCGTGAGTCAGACTTGGATTCCTACTCG
TGCGTGATCATGGACGAGGCCCACGAGCGAGCTCTCAACACGGATGTGCTTTCGGTATCTTACGCAAGGTAGTCCAACGTCGCAGCGACTTCAAACTTGT
TGTGACGTCGGCTACGTTAGATGCTGACAAGTTTGCCGATTTCTTCGGTGGTGTGCCCATGTTTACCATTCCTGGCCGAACGTTCCACGTAGATACGCGG
TATGCCAAGTCACCCAACGACGATTACGTGGACGCTGCAGTGAAGCAAGTAATGCAAATTCATTTGTCGCACCCGCCGGGTGATGTCCTGGTGTTTATGA
CAGGTCAAGAGGACATTGAAGCTACCTGTTACGTGCTAGCGGATCGAATGGGCAAGCTAGACGGTGCACCCCCACTCATGGTTCTTCCCATGTACTCTCA
GCTGCCCGCAGACTTGCAGGCAAAGATTTTCGACGCCTCCGACGTGAGGAAATGTATTGTCTCAACGAATATTGCCGAGACATCACTTACTGTGGATGGT
ATCAAGTACGTTATCGATGCAGGATTTTGCAAGGTGAAGGTGTACAACCCTAAGATTGGAATGGACGCGTTGCAGGTTAGCCCCATCAGTCAGCAAAACG
CCAATCAACGTGCTGGTCGTGCTGGTCGTACAGGCCCCGGAGTGGCCTACCGTTTGTACACGCAGCGACAGTTCGTCAACGAACTACTTGAAGCGCAGAT
TCCTGAGATTCAGCGAACGAATTTGGGTTATGTGGTGTTGTTGCTCAAGTCGCTGGGAGTCTCCAACCTGCTGGAGTTCGATTTCATGGATCCACCGCCG
CAGGATAACATCATCAACTCCATGTACCAGCTTTGGGTCTTAGGAGCTCTGGACAATACTGGTGAGCTTACAGAAATTGGCAAAAAGATGGTGGTATTCC
CGCTGGACCCACCTTTAGCCAAGATGTTGCTATTCAGCGAACAGCTTGGCTGCTCTGCCGAGGTGCTTGTAGTCGTTAGCATGCTGTCAGTTCCAAGTGT
GTTCTTCCGCCCGAAGGATCGCGAAGAAGAGAGCGATGCTGCCCGCGAGAAGTTCTTCGTGCCTGAAAGCGATCACCTTACACTGTTGAATGTGTATCAG
CAATGGGAAGCCAACCGCCACTCAGCCCAATGGTGCTCCGATCACTTCATTCACGCGAAGGGCTTACGTAAGGCTCGTGAGGTGCGCGAGCAGCTTGTAG
ACATTATGAAGCAGCAGCATGTGCGCCTTCGATCATGTGGTGGGCGCTGGGATGTTATTCGTAAGGCAATTTGCTCTGCGTACTTCTACAACTCGGCGCA
AATTAAAGGCATTGGAGAGTACGTAAACATGTTGACGGGCATGCCGTGCAACTTGCACCCCAGTGCTGCATTGTTTGGGCTTGGTTACACCCCGGATTTC
GTTGTGTACCACGAACTCATCTACACAAGCAAAGAGTATATGCAGTGCGCTACGGCTGTGGAAGGTGAGTGGCTTGCAGAGCTGGGTCCCATGTTTTTCA
GCGTGAAGGA