Description :
From Genome Similarity Track
Location :
Scaffold_13:650730- 654881
Sequence
4151 bases(100 bases per row)
TGATCTCCAGTGGTAATGCCCTACCTCCACCAGCATACGGCGTAGTGTGTGACATCGACGTACTAGGGCATCCGCCAATCCGCCAACGAGCCCGCCGAGT
TCCGCTGAAGCATCTCGGCAAGTTGTACGAGCTGCTCAAGGCGCTGTTACGGGCTCGGCTAATTGCCTTCTCGAACAGCCCATGGGCATCACCCATCGTG
ATTGTCCTAAAGAAGAATGGGGTCGACATTCGGTTGTGTATCGACTACAAGCTGGTAAACGCGATTACGGTGCTCATGGAGTGTGCCATGCCGCTAGTGG
ACGATCTCCTCACGGAGTTGGAAGCGTACCTATGGTTCTGCTCTTTGGATGCTGCTAGCGGTTTCTGGGCGGTCATAATGACTCGACGGGCGCGTTGGAT
CTCGGCTTTTGTTTGCGCGCTTGGCCACTTCGAGTGGCTGCGGATGCCCTTCGGATTAAAGAATGCCCCTAGCGCCTTATTGATAACGCCCTGTGGGGTT
GCGTACAACCCAAGGGCGGCTGGAAGGTGCTCGCCAAGCGCATCCAACAAGCGGAAGCCGCCTCAGAAGCTCAGCGGAAACGGCTCGCAGCCGACATCGA
CTTTGAAGCCAGTGGCCAGACCAAGTTTGAGGCCGACCGCCGAGCTCAAGCTGAGTTTGACCCATTGGAAGAATTCATGAACAGCCGAGAAGCCGGCATG
TTCCGGACGGGTGAACCTGATGAATCGTGCCTTGCACCGGTTTTCGACCGGCGATCGTTTGTGGACGATATCGGCTTCGGTGGGAGGACGTTCGACGATT
GCTTGGGGACGCTTGACCGATTGCTTCAACGCTTCACTGAATGCCGCATCAGCTTCCCGAAAAGCATCTTCGTCCAACCTAAAGTCGACTTCCTGTCACA
TGGGGTTACCTCGGCTGGAATCCAAGCCGACCAGAAAAAGATGCTGGCGATAGCCGGGCTACCGTTCCCGACGACGAAGAAGGGGATGTAAGCATTCTTA
GGAGCGCTGAACTACTACGGCCGGTTCATCCAGAACCTGGCTGTATATGGGGCGGTCCTCTATCAGCTGAAGGATGATGATTTCGGACCTGGCGGTGATC
TGACGGCCGCAAAAGCGGCGTTCGCCGAGTTAAAACAGCAGGTGGTCGATGCACCCATACTCCGCCACTTCAACTCGGCTGAGGACGTCCACGTTATGCT
ATTCGTCAATGAGTGGGCTCTGAGTAGCACGCTGATGCAGCTCCACGACGGGAAGCTCCATCCAGTGCGGTTCTGCAGCCGAGTCCTCAAGGATAATGAG
CTCGGCTACCATCCCGCCGAGAAAGAAGTTCTCGCCTTTCTACAGCTCATCAAGGTGTGCCACACGTTGCTCGCCGGGAAGACCATCCATGTTTACACCC
GCTACTCGACTCTCGAATGGGTGTTCCAGTCGAAGTCTCTCTACGGCAGAGCAGTCAGCTTTGCGGTACTGCTATCACCGTTCCACCTAAAGGTCAAGCG
GGTCCGCGAACGGGACACGGATTTCGCCCAGTTGCTCCAAGCGTCCATCACGCCGGCAGTGGGATTGGACGAGCTACTAACGCATGTCACTCCATCAACT
CGGCTGTGGTCCGCATGGACCCAGAATTGCTGTATGCGCATGTGCCCCGAGACTTCAAGGGACACGTCCTATCGTTTGACGGATCGGCGAAGACTGCTAA
ACACGGCGGGTTCGGGAGTTGTTCTTGGATCCTGTGGCGTTTGCCAGACTGGAACATTGAGATCGCTGCGAGCGCGCACCTCCCATCGACCACGGTGAAT
ATAGCCGAGTACAGCGGCATGAACAATGGGGTGACCTCGGCCATTGAGCGCGGGGTGACGGATTTGATCATCGTGGGCGACTCTCGGCTTGCGATCCAGC
AATCCATGGGGGTGATCGCGTGTAAGAAGGAGGCATTGCAAGTCGAGTTAGCACGCCACAAGAAATTGGTCAGCAAGCTGAATTCAGTTCGCTACCTCCA
CGTAGTGCGTCTCTACAACTCGGCTGCTGACTCTTTAGCGACCGAAGCACTGGAAACCAAAGCAGGAAAGGTCGTGCTAAGCGCCGGACGGAAAGCCGAG
TTGAAGACCCTAAACAGGATCTCTGAGGTCCTGTACGTGGACACGGACTCGGCTGCAGCCCCGGCCGAGGGTGTTGAGATGGCTGCCGTGACAAGGAGTC
AGGTCCGCCGAGTCTGTTTCGAAGACGAAGCGGCAGAACACCCAGTCCCGGACCCAGCTACGGATGAGGAAGCCGAACGTAATGACTTTGAACGGGATAG
CCGACCTCCGCCTGCTAGACAGCGGGTGACGGGAGAAGCCGAGTTCGGTAGCGTAGCACCACGAGCTAACCGAGCTGAGCTGGTAGCCGAGCTCGGAGAA
GCCCGGGAGCCCAACGCCATGGACATCGATCCGGTAGTGGTCCAAGCTGAGCGCCGCCTGCGAATACCAAGAGCTCAAGACGAGGAACAACGATGGGCCG
ACTTGAACACCTACCTGAGAGGGGATTATGCGCACCTCACACATCGCCGAGCTCACAACGCTGGGAAAGTTACCGACGAGTTTGTCCTCAGCGAATTCGG
GCTATTGTACCGACAAGGCAAGGCCCGACCACCTGGCGAACTCGGCGAACTAGGCTTATCCCTTCGACTGGTGGTTCCGACGACCATGATAGACGAGGTC
CTGCAGAACTGCCACAACTCCATCGAGGGAGGCCACCAAGGGATTGTGCGGACATACCACAGGGTCAGAGCCGACTACTACTGGATTGGGTTGTACGCAG
ACGTGGTCAAACATGTCCAAGCGTGCGAAGACTGCAGTACCAGTAAGAGCAAACCACACCTGAAGGGCTATTCACCTGGCAACGTAGTGTCTGAGCGACC
GTTCCACGTGGTATCGATGGACTTTGTCATACCACTGCCGAAGACTCGGCGGGGCAACACTGCACTGCTGTTGTTTCAAGACCACTTCACCGGTTTCGTG
ATTGCTAAGGCAATGAGTGAGACTGGGGCACTTGAGGAAGCGAAGGCCTTCGAAGAGAAGGTGTTCCGGAGGTTTGGAGCTCCATCACTGGTACGCCACG
ACAGAGATCCCCGGTTCATGAGTGAAGTGTTCCAGAAGTTCTCGGAGATGATGCAGTCCAAGTCGAGAGCGACGCTGAGTTACCGACCACAAGCCAACGG
TCAGCAAGAACGCTCAGTGAAGACCATGATCCAGACTGTGCGTGTGTACGTGGAAGACCCTCTCCAAGCCGACTGGGATGATGTAGCCGAGAAGCTCGTC
CATGCCATCAACAATTCGAGAGACTCGACTCGGCGGGAGACCCCGTTCTACCTGGTACACGGATGGGACGCTCGGTCTACACTCAAGGCGATGACCGAGT
CAGTCAGGCTCGGCAGGGGCAACTCAGGTGACTCAACGGGGGCAGCCGAATGACGCAGGGAAGCAAACCGACAGAGAGAGGTGGCTTTGAAGCTTGCGGC
CGAGTTCCAGTTGAAGGAGAAGAAACGGAGAGCGAAGAAACACAATGACGGACTCAGCCGAGTCGAGCAGGGAGCTGTCCCAGCCGGGGAGGAAGGGACG
GATACCCCAGCGAACTCGCCCGAGAGAGCAGTCGAGTCGACTGAGGAAGGTGACGAGTTAGCCGAGTCGAGGAAGTCACTATTCAAGGAAGGTGACCAAG
TTTGGTTGTTCATGGAACGAGTCAGACCTGGCTTGACCAAGAAGTTACCACATCGATGGCATGGGCCATTCCGAGTGAAGAAGAAGGTGGAGGATTTTGC
CTACGAGCTCGAACTCCCGGACAAGAGCGGATACCGTTTCTACCCTGTGATACATGTGTCACGTCTGAAAGCGGTCACGGGACTCGGCGAGCGGCCGACA
ACTAGGCTAGTAGCCGACTTAGCCGAGTCGGATCGTCTCGACGTTGACGAGGAACTCCTTCCTGAAGATAGCTGGGAGCCCGACGAAGCAATGAATGAAT
AAGAAGTCGAAGCCATCCTGGACGACGAGTTGCCGCTCTCTACGAGCACCTCCAGAACTCAGCGGAAGTTCAAGGTCAAGTGGGTCGGCTATGATGAGCC
AACCTGGGAGCCGCTGTCGAATTTGTCGTGTGGGGGATTATTGTTCGATTA