Description :
From Genome Similarity Track
Location :
contig_30:650640- 653354
Transcript NameFunction/comments
g6367.t1hypothetical protein

Sequence
2714 bases(100 bases per row)
TTCGCTGCTCCTCGCGAAGATTGAATATGTAGACACACGTGGAATGTTAATGGTTGGTGGTAATTACTTGTGGCTGGTCCAGAGATTTAAGCCACCGGAC
CCGACAGCCCAACCCGGAGGTTGAGTTCAAGCACAAGTGACTTTGTGCCTTACCCAGCAAGGGCCGGGATCCGTACCCCTCATTACACTATGGTTTTTTT
TCGGCAGTGGGGTCTCGTTGCGGTAAACGACCGACCTATGGGCCGGCTACTCGTCCACTTAGTTGCCTATCTCCGGCCTCCGTAGATCGACCGCACTCGG
CGGGTATTGATCCCGGTACCTCCCGGTCTCAGCGTCAGGGTATTACCACTGGCCCACTGAGGTCGGTTTGTGGCTGGTCCAGAGCAAACGCAAGATAACC
TTATTCAAGTCACACGTGAAACTGAATAAAACTAAATTGAACAATGAGTGCATCTAATTGTATACTGTATTTATAAGGTTGAACTGACGCTACTCAAAGC
CGTCGAGCTCCATCGCATGCGTAACAGCCATTATTTAGCATGGCGTACATGAGCCCATGTACATCCAACGAGATTGAACGTCGACCCGATAGTGCCACAG
CATGCTCTCCACGTCCTCAACCGTCGCGTACATCGTGACCGTGAACTAGACCAGCACTCGTGGGGTCAACATGGTTTGCTCACGGCGACCACTGCTGCAA
TGGGGTTCTTGTACAACTTGTCCGTAAACAGCTCCAGCGCAGGTGGGCCCAACACTTACATGGGGTCGGCATCGCGGTTGGCGTGGTGTAGCTGGTTAAG
CGCTTGAAAGTAAATTGCGAAGTGATATTGGAGTTAGAGTGCCTTGCCGGCATGTTTCCTAAAGCTGCTACCCTTGGCTGCTCCCTATGATCCTCTTACT
CCTCCTTCAGATCGGTCTTCGTGCTCCTTACCATCTGAAGCCTCTTGATTTCCCGTCGATCGCTTCACCGCTGTGAATCCTCCTCTCAGCAGTCTCCACG
TCTCCACATCATGCCTGCACTGCCATCGTGCAGGTGTCATCGAAGCTCACACCAATAGCCAAACACCACGTCGATGCCTGCTGCCTTGGCAGCACATCGT
CCCAGCGCTCGCCATGATCTCAGCCACTAACCGGCCGCCACGGTCGACACTGTCACGCTCTCTACGAGAGCTGTCTTCCCAATGATGGCTCCGAGCACTA
CACTACAGCTTGCGTAGAGTCTAGTGGAGCATAGGTTCCAACTCCGTGTGTCCGCCATCAGCAATGTATCGCTGAACAATGGTCGGGACATCCGAGTAGA
CGGAGTCAAATGGTTCCCACGAGTTTTCATTGTCCTCCAAGCCACGCCACGCGACGAAAAGCTGCCATTCTTTTGCTTCATCGTTGTACCGGTGCTCTGT
AATTGCGCGCACGCCAAGCACAATGCCTTGGTTGGCAACGTTTCGCGGAGTCCCTCCGTTACATCCAAATCGGCATCGCAGTAGTGCTTTAGGCGAGAGC
CGTGGACCTCATAGACGTCCTTGGTCAACAAATGTTCCACCATGAACGAATTGGCGAGGGCTTCGGTAACTCGGAACGGCCCCACCCAACGAACGAGCAG
TTTGCTGCTCTGCAGTCGTTTATCCACGCGTAACCACAACACGTAGTCGCCTGGCTCGAAGTTGCGCGTGCTACCCTTTGACCTGGCCATGTTGGTCAAA
CGCTTGCGTTCCTTGCGTTCCACGACTTCACTATGCATTTCGCGGAAATGAGCATGCAGGTTGTCAAGCTGCTCACTCAGACGCTCTAAATCCAACGACA
GCACTCGGGGTGTCCGTCCATCGGGCACCACCACACAGTCGAGTGGCGACGCAGCTGGGAGTCCAGCAAACAACTCAACGGGGGCGTGTCTTCCCAGTGA
TTCCACGGCGGCATGGTTTAAATTTGCCTGGATAATAGGCAACAAGTACAGCCAGTTGCCTGTGTCGAGTTGTAGTTCCAGCAGCATGACCCGAAGCACT
TGCAATATGTCCCGGTTTACTCGCTCCACAGTCCCATTGATCCAGGGCGTGTGCACTGGGACGAACTTCTGCGTTGCATGCAGACGTCCTGCCAGTTCCT
TCATCACCTGTGCCTTAAAATGCGAGCCGTTGTCGGAAACCCACTCTTCTGGCAGCCCGAATCGCTTGAACCAATCGTGCACAGCCTCCGTAGCAACGCT
GCTGGTCGGTGCATCCGAAGCGGACAACTCGCAGTAGTGTGTTAGCTCATCCTTGAGCACTAGGACGTAAGCCGAGTCACCGTAACTCTCACCAAGAGAC
AGGTAGTCGATGTGTAGACACTGGTTCCGTCGGGTTGCCGTTGCGGTTGGACACCATGCCCTTTGAATCAGCCGGCCACCTTTGACATGTTTGCACAGCA
GACATTTCCGAGCAAAACGACTGACTACTTCCCGCAGCCGAGCGATACTGAATCGCTGCTGTACACTTGACAGCATAACGTCGGCACCACGATGTCCTTG
TTGTCCACAGTGCGCAACTATCAGGATGCGCTGCAGTAATTCCTTAGCATCACCAGGTATCCAAATCTTCCCATCATGACGAAACACACCATCGTCATCT
GCTGCAACAGGGGCTGCATTACGATAGCGTTGTTGCTTCTGCCGAACAGCATCCAGAGATGGCCACTGAAACGCCGCATCTTGTAGTGGACGTAATGATG
ACAGTGGCTGCACA