Description :
From Genome Similarity Track
Location :
Scaffold_825:6506- 7785
Sequence
1279 bases(100 bases per row)
CGCAGTGCGAAAGCACCTCCGAAACCGCAAGCCGTAGGGCCGAAGACCAGGGCGGCCAAGGCCAAGGACGAGTCGTCCGCGCTGATGGAGGCCACGAAGG
CGGCCGAGGAGGTGGTGCGCTCACGTAGCAGCACGCCGGAGAGTGGCCGTTAGGCCGGGGCTCGGAGCAAGTCTCCTGACGCCGCGCAAGGCAAGGAGGA
GAGTCCTCGGGGCCATAAAAGCCCGGCTCGCGACTGGGAAGCCGCCGTCTTTGACTGCACGATGGTCCAGTACTCCGGTGAGAGTTCACCCGACGACGAG
AACGTAGCACGCACGCTGCCGAAGGCACGGAGCTGGCGGCAGGCGACATGACCAACGTCTCGGCCGACGCAAAGGCCTCGTCAGAGAAGGATGCGGAGGA
CGCCGAGTCCGGCTCAGGCGACAGCAAGCAGTCGCACGACGAAGTCGCCATGGCCGACGCTGGGGTCGTGGCCGAGAAGTCGCCGAGCGACGCGGGCTCC
AAGCCCAAGGAGGTGCTGGCATCCAAGCATCTGACGCTGGCACAAGGTCGTGAGCGTGCCCAAGCATCGAAAGCGGCTGCCGCTGCGAAGGCCGCCGAGG
CCAAGGCGAAGAAGCGTTCAGCTTCCAGGTCGCCTCGCGGCTCCAGCTCCAAGCTGTTCATCGACTCGGAGTCTGAGGACGAGGAGGGTGCCGTCCACGA
GCCCAAGGAGCTCTCCAACAACCTCGACGAGCAGCAGCAGCAATACCACGCTGCTAGCTCGGGTGCGTATGCCAGGCAGCCGACTGCCACGACTGCCATC
GAGTCTTCTTCAGGCGGGGATGCCACGTTCCCGCAGGGCTACTTCCCGCCCGAGCCTGGCACTGGTGCGCCAGCGCTGTTGGAGAAGCTCTCGGCTCCTC
GTGGCCTTATCGGCGGGTACACCTCGAGGGGTTCCTATGAGCGTGCTCTTGTTGAGAAAGAGCCACTCTTTCTTGGCGACGTTGAAGTCGCCCGGTGTGT
GCTACTAGCACCACACAAGCTCACACTGAAGGAGTTCACCACGCTTCGCAAGAAGCCGAAGGACAAGGGTGGACTCCATCCTGTGTGGGGTTTCCACTGG
GTCAAGCCGAATGACAACATGACCTGGAGCGTGGTGGAAGACCTCTTCTGGCGCTACGTCCAGCGCAAAGGGTATTCCGACCAAGAGTTCAAAGAACTCC
GTGAGGATCGCACTCTGTCCGCTATCCTGGACCCGCGAGCTCCGCATCGAGTTCGCTCAATACGTGAGCTAGCGCATGC