Description :
From Genome Similarity Track
Location :
contig_30:650596- 653346
Transcript NameFunction/comments
g6677.t1hypothetical protein

Sequence
2750 bases(100 bases per row)
CTGGGGTTCGCTGCTCCTCGCGAAGATTGAATATGTAGACACACGTGGAATGTTAATGGTTGGTGGTAATTACTTGTGGCTGGTCCAGAGATTTAAGCCA
CCGGACCCGACAGCCCAACCCGGAGGTTGAGTTCAAGCACAAGTGACTTTGTGCCTTACCCAGCAAGGGCCGGGATCCGTACCCCTCATTACACTATGGT
TTTTTTTCGGCAGTGGGGTCTCGTTGCGGTAAACGACCGACCTATGGGCCGGCTACTCGTCCACTTAGTTGCCTATCTCCGGCCTCCGTAGATCGACCGC
ACTCGGCGGGTATTGATCCCGGTACCTCCCGGTCTCAGCGTCAGGGTATTACCACTGGCCCACTGAGGTCGGTTTGTGGCTGGTCCAGAGCAAACGCAAG
ATAACCTTATTCAAGTCACACGTGAAACTGAATAAAACTAAATTGAACAATGAGTGCATCTAATTGTATACTGTATTTATAAGGTTGAACTGACGCTACT
CAAAGCCGTCGAGCTCCATCGCATGCGTAACAACCATTATTTAGCATGGCGTACGTGAGCCCATGTACGTCCAACGAGATTGAATGTCGACCCGATAGTG
CCACAGCATGCTCTCCACGTCCTCAACCGTCGCGTACATAGTGACCGTGAACTAGATCAGCACTCGTGGGGTCAACATGGTTTGCTCACGGCGACCACTG
CTGCAATGGGGTTCTTGTACAACTTGTCCGTAAACAGCTCCAGCGCAGGTCGGCCCAACACTTACATGGGGTCGGCATCGCGGTTGGCGTGGTGTAGCTG
GTTAAGCGCTTGAAAGTAAATTGCGAAGTGATATTGGAGTTAGAGTGCCTTGCCGGCATGTTTCCTAAAGCTGCTACCCTTGGCTGCTCCCTATGATCCT
CTTACTCCTCCTTCAGATCGGTCTTCGTGCTCCTTACCATCTGAAGCCTCTTGCTTTCCCGTCGATCGCTTCACCGCTGTGAATCCTCCTCTCAGCAGTC
TCCACGTCTCCACATCATGCCTGCACTGCCATCGTGCAGGTGTCATCGAAGCTCACACCAATAGCCAAACACCACGTCGATGCCTGCTGCCTTGGCAGCA
CATCGTCCCAGCGCTCTCCATGATCTCAGCCACTAACCGGCCGCCACGGTCGACATTGTCACGCTCTCTACGAGAGCTGCCTTCCCAATGATGGCTCCGA
GCACTACACTACAGCTTGCGTAGAGTCTAGTGGAGCATAGGTTCCAACTCCGTGTGTCCGCCATCAGCAATGTATCGCTGAACAATGGTCGGGACATCCG
AGTAGACGGAGTCAAATGGTTCCCACGAGTTTTCATTGTCCTCCAAGCCACGCCACGCGACGAAAAGCTGCCATTCTTTTGCTTCATCGTTGTACCGGTG
CTCTGTAATTGCGCGCACGCCAAGCACAATGCCTTGGTTGGCAACGTTTCGCGGAGTCCCTCCGTTACATCCAAATCGGCATCGCAGTAGTGCTTTAGGC
GAGAGCCGTGGACCTCATAGACGTCCTTGGTCAACAAATGTTCCACCATGAACGAATTGGCGAGGGCTTCGGTAACTCGGAACGGCCCCACCCAACGAAC
GAGCAGTTTGCTGCTCTGCAGTCGTTTATCCACGCGTAACCACAACACGTAGTCGCCTGGCTCGAAGTTGCGCGTGCTACCCTTTGACCTGGCCATGTTG
GTCAAACGCTTGCGTTCCTTGCGTTCCACGACTTCACTATGCATTTCGCGGAAATGAGCATGCAGGTTGTCAAGCTGCTCACTCAGACGCTCTAAATCCA
ACGACAGCACTCGGGGTGTCCGTCCATCGGGCACCACCACACAGTCGAGTGGCGACGCAGCTGGGAGTCCAGCAAACAACTCAACGGGGGCGTGTCTTCC
CAGTGATTCCACGGCGGCATGGTTTAAATTTGCCTGGATAATAGGCAACAAGTACAGCCAGTTGCCTGTGTCGAGTTGAAGTTCCAGCAGCATGACCCGA
AGCACTTGCAATATGTCCCGGTTTACTCGCTCCACAGTCCCATTGATCCAGGGCGTGTGCACTGGGACGAACTTCTGCGTTGCATGCAGACGTCCTGCCA
GTTCCTTCATCACCTGTGCCTTAAAATGCGAGCCGTTGTCGGAAACCCACTCTTCTGGCAGCCCGAATCGCTTGAACCAATCGTGCACAGCCTCCGTAGC
AACGCTGCTGGTCGGTGCATCCGAAGCGGACAACTCGCAGTAGTGTGTTAGCTCATCCTTGAGCACTAGGACGTAAGCCGAGTCACCGTAACTCTCACCA
AGAGACAGGTAGTCGATGTGTAGACACTGGTTCCGTCGGGTTGCCGTTGCGGTTGGACACCATGCCCTTTGAATCAGCCGGCCACCTTTGACATGTTTGC
ACAGCAGACATTTCCGAGCAAAACGACTGACTACTTCCCGCAGCCGAGCGATACTGAATCGCTGCTGTACACTTGACAGCATAACGTCGGCACCACGATG
TCCTTGTTGTCCACAGTGCGCAACTATCAGGATGCGCTGCAGTAATTCCTTAGCATCACCAGGTATCCAAATCTTCCCATCATGACGAAACACACCATCG
TCATCTGCTGCAACAGGGGCTGCATTACGATAGCGTTGTTGCTTCTGCCGAACAGCATCCAGAGATGGCCACTGAAACGCCGCATCTTGTAGTGGACGTA
ATGATGACAGTGGCTGCACACTCCTTGTCGTCACGCGCTTGAACGCGACC