Description :
From Genome Similarity Track
Location :
Scaffold_1:650545- 656282
Transcript NameFunction/comments
Hyaar_Emoy2800146phosphatidylinositol-4-phosphate 5 kinase-like protein
Hyaar_Emoy2800147hypothetical protein
Hyaar_Emoy2800148predicted protein

Sequence
5737 bases(100 bases per row)
TCTCGTTCAGCACCAGTTGACATTTGCTGACGATAAGCTGCATAAGCTGCTGATGGATGGGCCGCATTTCCACTCTCACTAACAGCAACTGCAGTAAATG
CCGCTGCAGCGGCAACATTAGTACCTTTTGTCTGCGGTAACAACGCCAAATGCTGGATGCGCTGCGACGCCGGTAGACGTTCAGCCGCCTGAACAGCCTG
GATTATCCCCGACGTGGTGTAAAAGAGCACTTCCCGTCGCAACGCCGCGTTCACCTGCGGGTTCAGATCCACGTCAATCTCGCCTGTGTTTTCTCCTAGA
CAGTGCGTAAAGTGCGCGACGTGGAAATCGTTCAACGCAAACCAGATCACGAGATCAAGGTACCCTTTTCCAGCAATCAGGAAATTCAAGAGCTCGCTCG
ACCTGTCCGGCTGCGAGCGGTCTCTCGACAAGAACTTGATGTACACAATGACGACAATAATCCAGTAAAAGGTCACGGCAAAGACATTAAACCTCGCGCG
ATTGATGCTCTGGACACGGACTGCATACGTCTCGGGCATGCCTTCACTCAGTCTCTTCCACGCCCAGATCCAGACCGCGATGCCGGAGATAATGAAGAGC
CCCATCCAAATGTAGAAAAAGAGCCAGCTAATGATATTGGCGTTCACCGCGGTGTAGCTCTCGGAAAAGTTGTCCGTAACAATGTACCCCGCGGTACAGT
TGGTCATATCGTCCGCCTCCAAGTTCTTCAGCGCGTTCGTCCAGCACACGCCTAGATCCGAGTAGCCTGACCAGTCGTCCGTCTTCATGAGCAAGAGCCC
CAGCACAAGCGGCACAAGCCACGAGCCGAGGTGGAACATGCGCGTGTTGCGCTTAAAGTCCGTAAACGGGTTCGTGAGACTCAAGAGCAGGTTTAACGTC
ATGCAAAAGAACCAGCACTCGGACGCCAAGAGCGTAAACTCAAAGAGCCCGGCAAAGAGGTCGCACGTCGAGCTCGCCGTGCTGGCCGTGCTGCAGCCGC
ACTGCAAGTTGGTACTGCTGCAGAGCGGCACGCAGTCGAAGAAGAGGCAGCGGACAAACTGCTGCGCCAGGAGCTGCAACACGAACACGGCGTCGGCGAT
CGTGCGCCAGAACACGAGTGGGTTCGGGTGTTGCCGGTAGCTTGGCACGCTTGCGTACGAGAGGATGACGAAAAAGACCGAGAAGATCGAGAGCACGCCG
CCCCAGATGAGTCCCGGGCTGAGGTTGTCGTACGTGCTGCCCATGGCCAAGACGAGCGCCGTGACAAAAGCTGCGAACATGACGAGCTGGAACCACCGCG
TCGTAGACTGCACGCACGTGTGGAGCGTCGTGAGGCCCACGACGCGGCGGTCGAATGGCTGCTGCTCGTCGTGGTGTCTCATGCTTGATGCGGGATGGTT
CCGGTCATGATGCGACGAAGGTGATGCATTGGAGGACGAAGGGATGCCAAGAGATGATGGCGTGGAAGACGAGGCGGCGGGGTAGGGGTGCGGGTAGGTG
TGCGGGTGCGGATAGGGGAACGATTGTTGCGGAGGCGGGATGGGGTTGGGGTTGCGGTTGCGGTGCTGGTGCTGGTGGCGGCTAGGGTTGGACGCGGGTG
CGCGCGCGCGCTCGTCCGACATGATGGCGCGTGGCGACTGGAGGACTGGCACGGGGGGAGACGCGCTAAAGCGGCGACGAGTGCTGCTAGTCGTGCTGGT
GGGTGCAGGACGGTGGGGACAGCTGCTGCTGCGTGTGCGTGCTGCGGGGACGGCTGCAACTGTGGTGGGGCAAGTATTGTGTCGTCCGTCTTCTTGACGT
CACCGAGGGACGCGAAACTGTCGCTACGGCGTAAAGTGGTCGATGTTGCGCGGAAAGTGGGGGTCTGACTACCAGGGGTAGGGGCGCTCTATATTTAGGA
GTTTGTGGAAGGGGGGAGGTCACGCTGACGGACGAATGAGGGACAAGAACAACCGTGGTAAACAATGGCGGACGTGGGACAGGGGCGTCTTGAAGTCAGA
GGAAAGTAGGGGTAGGGCTGACGTTGTTGTGAGAGGTTATGGCTATTTTTCTTCGTCGTGTGCACTGCAATGGAGCGTATCAACAAAGAATATACACTTT
CGCTGTTGCATACAACAAGTTGGTCCGAGCGTCATGAAGGATATGTGTCCACCGTTGTAAAAAGTTCGTTTTCGTATTGCAAGAATTTGCAGGTTCGTTG
GCGCCGGACATTCTCTTGGGCTCGTAGATCGTGAGATGTAAGTAAATAATGCCATTCAGTGACAAATTATTAAAAAATATATCGTATAGAAACGCCTAAC
AAAGCTATACAAAAACCATCAGACAGCACATTACCGATTTTTGACTCAATCTTAAATACAATTGGTGAATCCGTTTTTTACTCTGGTCAATCCCTATTGT
TATGTCAACAAAGTGTACGCACAAAATGTACATAAGATAGGGGAGCAAGCTCTGGAGCTCGCCCTTTGATATTAGTGATTCAGTTTGGAGAACTGAATCA
AGTTGCAAAACACTATACAATAGCAGTCACTGAAGAAGGAGTATGATGTTGTTAATGTATGTATAAATTTAATACAGTATACTCAAGCAACGCGATCAGC
CTTTGCTTATCAGCGTCCAGCGTTTGCTTATGTGATCATATTCACCTTTGATCGATTTAAGCCAATCACAAGCGTGCGCCACAATAGTGACTAAGCCAAA
GAGTGACTTCGGATATGCCTATATACCTATGAGGGGGGACAGGCTAGATCGTACTTAGTTCGCGCGAGGTACACCTAGCCGCGTTATTTACAGACAGACA
GACACAGATAAGTACGATTAAAAAGTTCGGTATTTAACCTTGCGCACAATCACTAATAGCTTCACCCTTCGGGCTCGCAAAGAAATAGATATTCGTTTGC
GACCGTTCACCCAGCAACTTTTGTGGCTTTCCGTCTCCATGCATAATCAATATAGGCAGTAGTCAAGAAACGTTGGCAAGGGAAACAAACGCGATGATAG
TCGTAGGATTCAACACGTGAACGCGATATTAGAAAGGGGAATGCCAAGTACGCGGCCTCACATCGCGTCATGGAGTGTATATATTACACCGCTTGCACGT
GTCGAATCCGAAGGCCTGCGCGTCACTTCGCGCGTTTGTCAGTATACATGATGCGCTTCTGTGCTCAAAATGTATAAACTTGACGCGCATGAAGAAGATA
GACATCGTGTTTGAACCGCTGAACTGGATTGGTGCCACACATATCATCAGACATTTGATCGATAATAAATTCCATGGTACGGTAGCAGATCTAGCCGCTA
AGGCGACATGTTTAGCAAAGACTGACTGAGATCGTAAAAGCTCTCACTCAATCTTCGTCGCAGGATTATCGGTCCTTGGTAGATAAGATACTCCATATCT
AGCAATATGATGGTTCAGTAAACTTTGCGGAATCGTATTGATGACAATCACTCGGGACATCGCATGTCCAACGACTCGATAGAAAACTTCAGAAACGGAC
GTATTGCGGGATTTTCGTACCAAAGTTCTCACGCGCTTCGTGCTACTGTGCACTTTCAGCATTACTTACCGACTTGCATAACCCATTCGCAGTTCATTTT
TTTCGTCTACGTATCAAAGAAAAACTGATAGAGAAGAGGGAATGCTGAAGCAATGGATCATAACCTACACATATCCACTTCAACATGCAATGGAGCCAGT
TTCCCCCCTTCGGTAATCCCGCGGAACAGAAAAAGGACCGACGTCATCAACTGAAGCCATTTCAGAATTAATGGCTGACGTGACGCCATGTGCCACCTCG
TTGACTGCAACGGATCTCGAGCGGGAGCACGTGCATAAAGTGTACGATGTCATTGCACGGCACTTTAGTCATACGCGCCATCATCCCTGGCCTCAAGTGA
CCGAGTTCTTGGCGGGATTGGCACCTCGCGCCCTCGTGGCGGACATGGGCTGTGGCAATGGCAAATACCTGCATGTGAACCCGTCGCTCTGTGTCATTGG
AGCAGATCGCAGCATCCCATTGATGCAAGTAGGAGCTACGAGCAACAGGTTGGCAGCAGTAGTAGTTCAATACAATTGCAATGGTAGCGCCTCAATGGCT
GCACTAAACTTGAGACGGATCGTGCCTTTCCTGCAGCAACTTGGTAGGGTGTGATGCACTGCAAGTGCCACTCCGGACTGGAGTATTTGATGCAGCCATC
TCCATTGCTGTGCTACATCATATATCGACTGAGGAGCGTCGAGTTGCATTGATCAGGTAGGACGGGCAATGTAATGTAGTTGCAAAGGAGATGGCCGATG
GTGAGTCGGCTCTTCTTACACGAAAAAAATCGCTTTTGTTTTGTAGTGAATTGGCTCGTATCGTGCGAGTGGGCGGTCAAGTGCTGATTGTCGCTTGGGC
ATTTGAGCAGGACAAGCACTCGAAGCGCCGCTTTGAGCAACAGGATGTCATGGTGGAGTGGAAACTTCAGCAGAAATATGCCAAGGATAAGGAGCGCGGT
GATACAATCGAAGCCCACGGGCAAATTGATCACAAGAAGCCCTGGGTGGTCTATAAACGGTACTGTCATGTGTATCGCAGCGGGGAGCTCGAAGCGTTGG
TCGAACAGGTGCCGGGTCTTCGATTGATATCGGCCGAGTATAGTCGCTCCAACTGGTGTCTCCGTCTACAGCGCGTTGCTTCCTAGACGGAATAAAACGA
CCTGTTGCAGTGATGATGAGCAGTGTTTCACATCCGTCGAATAAAGGTCATGGCCTGTCACGGATTTTTGTCTACTGTCGTTTGTATCTGCAGGTAAGTT
CATCAACTCGGCACATATTGGTGAACAAGTCAGCTTCGTAGAGTGGCCTAGGCAATTGTGCTGGATCGACATGCTCGTCGAGCAAAACGGCTGATCGCTT
TGCTGTAAGAGATCGGTACAAGCTTGCTAGAGTCCATGCCTAAGCGATGGCAAGTTGGCGTCGAAATGAGCACGAACCGACATCTTGTCGCGGAGCAATA
TTCGTCTTAATCCATGCCGATCGCTTGCACGTACCATGGTTCACGTCAGGTTGAAGGTATGATACTGCTTCGGAGATTCTTTTTCCATCATGTCCTGCGC
AGCATGGTGACAAGTCGAATTTGCAAATATGGGTAATGAATGAGCTGATAACGCCGGTGGGGAGTACAGTACAGCCAGAACGGAGCAACTGCTCGCTTGA
CCAGCCATTATTCTCGATACCTTGTAAGGTGAAAAGGCACGACCTTCATCATTGTCTAGCTGACAACTTGGAAGCAAAGCTCGGTAGACTTTATGGAGAC
GCCTTCGCATCTTCACGTTTCCTTGCCAACAACCTAAAGCTTCATGGCCGAGACGAACAAACGCATCAATGCAAGCCACAGGATGCCCATCACTTGATTC
CATCGATCATCAAACGAGTGAAGGTAAGTCCATGTACAATTCGTTAATCTTCCGTCAACACTTGTCTTTTCCAGTAGAAACTCCACCAAGCAGTCAAATG
CGGCGACCACTTTCGTCAAGCATAGATTCATGCTAGCTGCCAACTACTGTAGACCTCGTGTCACCATGTGGTTGTGAAGCCGGCAAAGAATGAATGGGAC
AAGGCAATTTGCGTGCTTTACCTACTACGAGGTTCGAGTTCATGCTAGAAGGCGCACCAGTGTCAAAAGTCCAAATCAACACATATCAAATCACCAAGGT
CCCGTGATAACAGCAGCAATCGTCAGTAAAAATGTGA