Description :
From Genome Similarity Track
Location :
contig_55:65038- 66869
Transcript NameFunction/comments
g11453.t1hypothetical protein

Sequence
1831 bases(100 bases per row)
CTGCCTATTTTCCAGTGTCGTGAAGAACTGCTGCAGGTGATTCGAGAGAATCAGATTGTGGTGATTGTTGGAGAAACTGGGTCGGGTAAAACCACGCAGT
TGACACAGTACCTACACGAGGAAGGATACTCTAAGTTTGGCACCATTGGATGCACGCAACCGCGTCGTGTTGCAGCAATGTCGGTGGCCCAGCGTGTCAG
TGAGGAAATGGATGTGACTTTGGGTGACGAAGTGGGTTACGCTATTCGATTCGAGGACCTTACGTCGGACAAAACTATTATCAAGTACATGACGGAAGGT
GTGCTGTTGCGTGAATCGCTGCGTGAGTCAGACTTGGATTCCTACTCGTGCGTGATCATGGACGAGGCCCACGAGCGAGCTCTCAACACGGATGTGCTTT
CGGTATCTTACGCAAGGTAGTCCAACGTCGCAGCGACTTCAAACTTGTTGTGACGTCGGCTACGTTAGATGCTGACAAGTTTGCCGATTTCTTCGGTGGT
GTGCCCATGTTTACCATTCCTGGCCGAACGTTCCACGTAGATACGCGGTATGCCAAGTCACCCAACGACGATTACGTGGACGCTGCAGTGAAGCAAGTAA
TGCAAATTCATTTGTCGCACCCGCCGGGTGATGTCCTGGTGTTTATGACAGGTCAAGAGGACATTGAAGCTACCTGTTACGTGCTAGCGGATCGAATGGG
CAAGCTAGACGGTGCACCCCCACTCATGGTTCTTCCCATGTACTCTCAGCTGCCCGCAGACTTGCAGGCAAAGATTTTCGACGCCTCCGACGTGAGGAAA
TGTATTGTCTCAACGAATATTGCCGAGACATCACTTACTGTGGATGGTATCAAGTACGTTATCGATGCAGGATTTTGCAAGGTGAAGGTGTACAACCCTA
AGATTGGAATGGACGCGTTGCAGGTTAGCCCCATCAGTCAGCAAAACGCCAATCAACGTGCTGGTCGTGCTGGTCGTACAGGCCCCGGAGTGGCCTACCG
TTTGTACACGCAGCGACAGTTCGTCAACGAACTACTTGAAGCGCAGATTCCTGAGATTCAGCGAACGAATTTGGGTTATGTGGTGTTGTTGCTCAAGTCG
CTGGGAGTCTCCAACCTGCTGGAGTTCGATTTCATGGATCCACCGCCGCAGGATAACATCATCAACTCCATGTACCAGCTTTGGGTCTTAGGAGCTCTGG
ACAATACTGGTGAGCTTACAGAAATTGGCAAAAAGATGGTGGTATTCCCGCTGGACCCACCTTTAGCCAAGATGTTGCTATTCAGCGAACAGCTTGGCTG
CTCTGCCGAGGTGCTTGTAGTCGTTAGCATGCTGTCAGTTCCAAGTGTGTTCTTCCGCCCGAAGGATCGCGAAGAAGAGAGCGATGCTGCCCGCGAGAAG
TTCTTCGTGCCTGAAAGCGATCACCTTACACTGTTGAATGTGTATCAGCAATGGGAAGCCAACCGCCACTCAGCCCAATGGTGCTCCGATCACTTCATTC
ACGCGAAGGGCTTACGTAAGGCTCGTGAGGTGCGCGAGCAGCTTGTAGACATTATGAAGCAGCAGCATGTGCGCCTTCGATCATGTGGTGGGCGCTGGGA
TGTTATTCGTAAGGCAATTTGCTCTGCGTACTTCTACAACTCGGCGCAAATTAAAGGCATTGGAGAGTACGTAAACATGTTGACGGGCATGCCGTGCAAC
TTGCACCCCAGTGCTGCATTGTTTGGGCTTGGTTACACCCCGGATTTCGTTGTGTACCACGAACTCATCTACACAAGCAAAGAGTATATGCAGTGCGCTA
CGGCTGTGGAAGGTGAGTGGCTTGCAGAGCT