Description :
From Genome Similarity Track
Location :
Scaffold_1197:6501- 8060
Sequence
1559 bases(100 bases per row)
CCGAGATTAGTGCGGCTCACCCCAAGCCAGCGAAGCCGAGTCTGCCATTCAGTTGCTAGATCCTAGGATGTGATCGGCTGATACCCTGAGGTCGAAGTAT
ACTTCGGAGAGTCCAATCGCTCGATTTATTTCTTGGCTGAAAACGTTATCCGAGTGGAGACAATTACACCAGCTGACGTCAACAGAGTTATCACTCCAGC
ACTTATGTGGGTCATCTCGCTTCCAGCCAGCTTGTGCCAGTTTGGTCCCCAAGTCCTTAGCGCTAGAGCAACACACAAGTGTTCTCTGACATTTATGGAC
AATTTGAACCCATTCTGTTAAGTTCCTCTATCATCTGAACTTCGTTTGTGTCGAATCTTATCTGTAAGAAACTATCTGCTTCTGGGTCAAGCACAGCCAA
ACCTACATTGGAGGAATCCGTGTACAATTCGACGTCGGGCTTCGGGAGATCACCAAACATGCGGAGGGGTAACGCAGTCAGCTGTCCGATACTTAAAAGG
TGACAAAACTATTCCAGGTCCGTCCTGGCACCTTTGGACAATTGACTCCTTCCGAATCGAGGAGTAATAGTTGACTGTGTGTGCATCCTCTGATAAAACG
GTTTTGCCGTTCTGAGGCAGGTCGCAACATGACGAAGGGAGCCCAACACTTGCTGAAACTCTGTCTTTGTTGAGTTTCCGCGACGTAGCATACAGTAGAC
GCCGTCCAAAGCTTTTGAGATTTTTTCTGCTGGAATCGACACTGTGCACCGTTCGATATTCCATAGCAACCCCAGTGCCACCAGTTCAGAGCTCCACTGC
AAAAATTTGGACTCATTGATGGCACGAGGGCTAAGCACTGCAAGCATCGCGTGGCGCAGCGTAGCCTCTGCTAACTGTAGGCGATCGTCGGCATCCTCTC
CCACCAAGATGTGGTCGTCGACCCATTCGTACGCATAGAATGTGTCGGTGTCCGCCGAGTCGGATACCTTAGCTGGAGAATTAGAACCCACATGCCACGA
AATTACCCGCCCAAACAGAGCGTAAAACGGCGGGGATCCCGGCCAGCTGAACGGAGCTGCGAAATCAATTATAAGAAGGCCCAATTCCTTTATCAAGACT
GCCATCCGGCACACTTGGTGGACTACGGATTGTAAATGATGAAACGGACCTTTGACGCCACCCTTTCGCATTCGAATCCGAACGGACCCACGACTTGCCG
AGAATTCAATACGTCGAACTATCGACATCACATGCTCATATCTGTCCCGCGGTACTGAATTGGCATCGAATGTCGAATTGACCGACTCATTTTTCGGGAA
NCAGGCCTAGGTAGCGATACCCTCGGAGTACTTGCCGTAATCGGTTAGGATCAAGAGATTTATTGGGTCGACTATCGTGTTGTTTCTCCACACACGAATT
CAGTTGCAGCTTTAGTTCGCAGTTTCTCGGCGCTAATAATACGAGAAAGAGAGTCGCATGAGGCTTTAGCGATGCTGTAAGTGTCCGATGCCACCACAGG
AGTACGTCGAAACTCGATGCGGCGCTGAATTTGAGATCATCTGCTTTCTTCACGCAACA